Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU097101

Sigma-Aldrich

MISSION® esiRNA

targeting human JAK3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCTCTCGGACAACATCTTCTCTCGCCAGTCAGACGTCTGGAGCTTCGGGGTCGTCCTGTACGAGCTCTTCACCTACTGCGACAAAAGCTGCAGCCCCTCGGCCGAGTTCCTGCGGATGATGGGATGTGAGCGGGATGTCCCCGCCCTCTGCCGCCTCTTGGAACTGCTGGAGGAGGGCCAGAGGCTGCCGGCGCCTCCTGCCTGCCCTGCTGAGGTGAGTTGCTACAGTGGCTGGAGAGACGACATCTGCTCCATGGGCTGGTGGCCGACAGTAATCTCACGCTGGGACCTGGCCTGCAGCCCCTGCCCCAGACCTCTCACCATCACC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... JAK3(3718)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jung Seok Kim et al.
International journal of nanomedicine, 13, 4817-4830 (2018-09-15)
Efficient target-specific siRNA delivery has always been a primary concern in the field of siRNA clinical application. In this study, four different types of anti-epidermal growth factor receptor (EGFR) antibody-conjugated immunonanoparticles were prepared and tested for cancer cell-targeted therapeutic siRNA
Longfei Pan et al.
Experimental biology and medicine (Maywood, N.J.), 245(15), 1395-1403 (2020-07-16)
Accumulating evidence suggests that vascular remodeling due to immoderate proliferation and migration of SMCs is a common process occurring in APE. In this work, we tried to find a breakthrough in the pathological mechanism to alleviate the prognosis of APE
Nina A Sibbesen et al.
Oncotarget, 6(24), 20555-20569 (2015-08-06)
Aberrant activation of Janus kinase-3 (Jak3) and its key down-stream effectors, Signal Transducer and Activator of Transcription-3 (STAT3) and STAT5, is a key feature of malignant transformation in cutaneous T-cell lymphoma (CTCL). However, it remains only partially understood how Jak3/STAT

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico