Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU096691

Sigma-Aldrich

MISSION® esiRNA

targeting human ADARB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AATCACGAGGGCTACTGCACAATACATGGCCTAAGTTCCCTCTGTTCCTTCCTCTGAATCGAATGGATGTGGGTGACCGCCCGAAGGCCTTCACAGGATGGAAGTAGAATGATTTCAGTAGATACTCATTCTTGGAAAATGCCATAGTTTTAAATTATTGTTTCCAGCTTTATCAAAGACATGTTTGAAAAATAAAAAGCATCCAAGTGAGAGCTGGTGAGACCACGTGCTGCTGGCGTAGTGTAGGCCAGACATTGACAGTCCTGACGGGAGCTCAGGGCTGCCCAGCGCCCAGCGTGCACGGGACGGCCCCACGACAGAGGGAGTCAGCC

Ensembl | nº de acceso humano

ENSG00000197381

Nº de acceso NCBI

NM_015834

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ADARB1(104) , ADARB1(104)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tingting Yue et al.
Neurochemistry international, 129, 104479-104479 (2019-05-31)
Previously we reported that gene expression of astrocytic 5-HT2B receptors was decreased in brains of depressed animals exposed to chronic mild stress (CMS) (Li et al., 2012) and of Parkinson's disease (Song et al., 2018). Depression is also one of
Zexiong Li et al.
Neurochemistry international, 134, 104689-104689 (2020-01-23)
The alcoholism and major depressive disorder are common comorbidity, with alcohol-induced depressive symptoms being eased by selective serotonin re-uptake inhibitors (SSRIs), although the mechanisms underlying pathology and therapy are poorly understood. Chronic alcohol consumption affects the activity of serotonin 2C
Tatiana Altadill et al.
Scientific reports, 7(1), 8803-8803 (2017-08-20)
Endometrial cancer (EC) remains the most common malignancy of the genital tract among women in developed countries. Although much research has been performed at genomic, transcriptomic and proteomic level, there is still a significant gap in the metabolomic studies of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico