Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU096051

Sigma-Aldrich

MISSION® esiRNA

targeting human GCH1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTACTCGTCCATCCTGAGCTCGCTGGGCGAGAACCCCCAGCGGCAAGGGCTGCTCAAGACGCCCTGGAGGGCGGCCTCGGCCATGCAGTTCTTCACCAAGGGCTACCAGGAGACCATCTCAGATGTCCTAAACGATGCTATATTTGATGAAGATCATGATGAGATGGTGATTGTGAAGGACATAGACATGTTTTCCATGTGTGAGCATCACTTGGTTCCATTTGTTGGAAAGGTCCATATTGGTTATCTTCCTAACAAGCAAGTCCTTGGCCTCAGCAAACTTGCGAGGATTGTAGAAATCTATAGTAGAAGACTACAAGTTCAGGAGCGCCTTA

Ensembl | nº de acceso humano

ENSG00000131979

Nº de acceso NCBI

NM_001024070

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... GCH1(2643) , GCH1(2643)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
HBU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jiao Xue et al.
The Journal of investigative dermatology, 137(10), 2059-2068 (2017-06-10)
Radiation-induced skin injury is a common side effect of radiotherapy and can limit the duration and dose of radiotherapy. Most early work focused on elimination of reactive oxygen species (ROS) after radiation; however, less is known about the mechanisms underlying
S Yuan et al.
European review for medical and pharmacological sciences, 23(11), 4564-4574 (2019-06-19)
To explore the effect of micro ribonucleic acid (miR)-124 on the spinal neuronal apoptosis and to explore its related mechanism. The rat model of spinal cord injury (SCI) was established, agomir-124 was injected intrathecally and the effect of agomir-124 on

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico