Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU095011

Sigma-Aldrich

MISSION® esiRNA

targeting human PRLR

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGGACAGATGGAGGACTTCCTACCAATTATTCACTGACTTACCACAGGGAAGGAGAGACACTCATGCATGAATGTCCAGACTACATAACCGGTGGCCCCAACTCCTGCCACTTTGGCAAGCAGTACACCTCCATGTGGAGGACATACATCATGATGGTCAATGCCACTAACCAGATGGGAAGCAGTTTCTCGGATGAACTTTATGTGGACGTGACTTACATAGTTCAGCCAGACCCTCCTTTGGAGCTGGCTGTGGAAGTAAAACAGCCAGAAGACAGAAAACCCTACCTGTGGATTAAATGGTCTCCACCTACCCTGATTGACTTAAAAACTGGTTGGTTCACGC

Ensembl | nº de acceso humano

ENSG00000113494

Nº de acceso NCBI

NM_000949

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PRLR(5618) , PRLR(5618)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yea-Hyun Leem et al.
Molecular neurobiology, 56(9), 6609-6625 (2019-03-25)
We investigated the effects of regular exercise on chronic stress-induced memory consolidation impairment and its underlying mechanism. We focused on prolactin (PRL)-modulated calcium-permeable (CP)-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors (AMPARs) in neurons in the CA1 stratum lacunosum-moleculare (SLM) area of the dorsal
Katja Linher-Melville et al.
BMC cancer, 14, 415-415 (2014-06-11)
Liver kinase 1 (LKB1) is an important multi-tasking protein linked with metabolic signaling, also controlling polarity and cytoskeletal rearrangements in diverse cell types including cancer cells. Prolactin (PRL) and Signal transducer and activator of transcription (STAT) proteins have been associated

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico