Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU094801

Sigma-Aldrich

MISSION® esiRNA

targeting human PDIA2 (1)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTTTGGACTCAAGGCTGAGGCAGCCCCCACTCTGCGCTTGGTCAACCTTGAAACCACTAAGAAGTATGCGCCTGTGGATGGGGGCCCTGTCACCGCAGCGTCCATCACTGCTTTCTGCCATGCAGTCCTCAACGGCCAAGTCAAGCCCTATCTCCTGAGCCAGGAGATACCCCCTGATTGGGATCAGCGGCCAGTTAAGACCCTCGTGGGCAAGAATTTTGAGCAGGTGGCTTTTGACGAAACCAAGAATGTGTTTGTCAAGTTCTATGCCCCGTGGTGCACCCACTGCAAGGAGATGGCCCCTGCCTGGGAGGCATTGGCTGAGAAGTACCAAGACCACGAGGACATC

Ensembl | nº de acceso humano

ENSG00000185615

Nº de acceso NCBI

NM_006849

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PDIA2(64714) , PDIA2(64714)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Esther Peña et al.
Thrombosis and haemostasis, 113(4), 891-902 (2015-01-30)
Protein-disulphide isomerase family (PDI) are an ER-stress protein that controls TF-procoagulant activity but its role in HVSMC migration and coronary artery disease remains to be elucidated. We aimed to investigate whether in human coronary smooth muscle cells (HVSMC) the ER-stress
Takamasa Inoue et al.
Journal of virology, 89(17), 8897-8908 (2015-06-19)
The nonenveloped polyomavirus (PyV) simian virus 40 (SV40) traffics from the cell surface to the endoplasmic reticulum (ER), where it penetrates the ER membrane to reach the cytosol before mobilizing into the nucleus to cause infection. Prior to ER membrane

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico