Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU093841

Sigma-Aldrich

MISSION® esiRNA

targeting human RORC

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGGAAGTCCATGTGGGAGATGTGGGAACGGTGTGCCCACCACCTCACCGAGGCCATTCAGTACGTGGTGGAGTTCGCCAAGAGGCTCTCAGGCTTTATGGAGCTCTGCCAGAATGACCAGATTGTGCTTCTCAAAGCAGGAGCAATGGAAGTGGTGCTGGTTAGGATGTGCCGGGCCTACAATGCTGACAACCGCACGGTCTTTTTTGAAGGCAAATACGGTGGCATGGAGCTGTTCCGAGCCTTGGGCTGCAGCGAGCTCATCAGCTCCATCTTTGACTTCTCCCACTCCCTAAGTGCCTTGCACTTTTCCGAGGATGAGATTGCCCTCTACACAGCCCTTGTTCTCATCAATGCCCATCGGCCAGGGCTCCAAGAGAAAAGGAAAGTAGAACAGCTGCAGTACAATCTGGAGCTGGCCTT

Ensembl | nº de acceso humano

ENSG00000143365

Nº de acceso NCBI

NM_001001523

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... RORC(6097) , RORC(6097)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yun-Jeong Jeong et al.
Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 68, 218-225 (2014-03-29)
Bee venom is a natural compound produced by the honey bee (Apis mellifera), and has been reported as having the biological and pharmacological activities, including anti-bacterial, anti-viral and anti-inflammation. In the present study, the inhibitory effects of bee venom and
Geyang Xu et al.
Molecular and cellular endocrinology, 416, 9-18 (2015-08-19)
Glucagon-like peptide (GLP-1), an intestinal incretin produced in L-cells and released in response to meal intake, functions to promote insulin secretion and to decrease plasma glucose. Ghrelin is an orexigenic hormone critical for glucose homeostasis. The molecular mechanism by which
Hong Zhang et al.
International journal of molecular sciences, 19(4) (2018-04-05)
20(S)-Protopanaxadiol (PPD) is one of the major active metabolites of ginseng. It has been reported that 20(S)-PPD shows a broad spectrum of antitumor effects. Our research study aims were to investigate whether apoptosis of human breast cancer MCF-7 cells could
Nishant S Gandhi et al.
Pharmaceutical research, 35(10), 188-188 (2018-08-15)
Lung cancer is one of the leading causes of deaths in the United States, but currently available therapies for lung cancer are associated with reduced efficacy and adverse side effects. Small interfering RNA (siRNA) can knock down the expression of
Jia-Hui Rong et al.
OncoTargets and therapy, 14, 289-300 (2021-01-21)
In recent years, radioactive 125I seed implantation combined with chemotherapy has been regarded as a safe and effective treatment for advanced non-small cell lung cancer (NSCLC). However, the mechanism underlying this success is still unclear. In this study, we investigated
Ver todos los artículos relacionados

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico