Todas las fotos(1)

Documentos clave

Certificado de origen (COO)/COA

EHU093841

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human RORC

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Todas las fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descripción

Línea del producto

MISSION^®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGGAAGTCCATGTGGGAGATGTGGGAACGGTGTGCCCACCACCTCACCGAGGCCATTCAGTACGTGGTGGAGTTCGCCAAGAGGCTCTCAGGCTTTATGGAGCTCTGCCAGAATGACCAGATTGTGCTTCTCAAAGCAGGAGCAATGGAAGTGGTGCTGGTTAGGATGTGCCGGGCCTACAATGCTGACAACCGCACGGTCTTTTTTGAAGGCAAATACGGTGGCATGGAGCTGTTCCGAGCCTTGGGCTGCAGCGAGCTCATCAGCTCCATCTTTGACTTCTCCCACTCCCTAAGTGCCTTGCACTTTTCCGAGGATGAGATTGCCCTCTACACAGCCCTTGTTCTCATCAATGCCCATCGGCCAGGGCTCCAAGAGAAAAGGAAAGTAGAACAGCTGCAGTACAATCTGGAGCTGGCCTT

Ensembl | nº de acceso humano

ENSG00000143365

Nº de acceso NCBI

NM_001001523

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... RORC(6097) , RORC(6097)

Categorías relacionadas

MISSION® esiRNA

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Melittin suppresses EGF-induced cell motility and invasion by inhibiting PI3K/Akt/mTOR signaling pathway in breast cancer cells.

Yun-Jeong Jeong et al.

Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 68, 218-225 (2014-03-29)

Bee venom is a natural compound produced by the honey bee (Apis mellifera), and has been reported as having the biological and pharmacological activities, including anti-bacterial, anti-viral and anti-inflammation. In the present study, the inhibitory effects of bee venom and

Ghrelin regulates GLP-1 production through mTOR signaling in L cells.

Geyang Xu et al.

Molecular and cellular endocrinology, 416, 9-18 (2015-08-19)

Glucagon-like peptide (GLP-1), an intestinal incretin produced in L-cells and released in response to meal intake, functions to promote insulin secretion and to decrease plasma glucose. Ghrelin is an orexigenic hormone critical for glucose homeostasis. The molecular mechanism by which

20(S)-Protopanaxadiol-Induced Apoptosis in MCF-7 Breast Cancer Cell Line through the Inhibition of PI3K/AKT/mTOR Signaling Pathway.

Hong Zhang et al.

International journal of molecular sciences, 19(4) (2018-04-05)

20(S)-Protopanaxadiol (PPD) is one of the major active metabolites of ginseng. It has been reported that 20(S)-PPD shows a broad spectrum of antitumor effects. Our research study aims were to investigate whether apoptosis of human breast cancer MCF-7 cells could

A Novel mTORC1/2 Inhibitor (MTI-31) Inhibits Tumor Growth, Epithelial-Mesenchymal Transition, Metastases, and Improves Antitumor Immunity in Preclinical Models of Lung Cancer.

Qianwen Zhang et al.

Clinical cancer research : an official journal of the American Association for Cancer Research, 25(12), 3630-3642 (2019-02-24)

We aimed to investigate efficacy and mechanism of MTI-31 (LXI-15029), a novel mTORC1/mTORC2 inhibitor currently in human trial (NCT03125746), in non-small cell lung cancer (NSCLC) models of multiple driver mutations and tyrosine kinase inhibitor (TKI)-resistance. Gene depletion, inhibitor treatment, immunological

Lobaplatin Enhances Radioactive 125I Seed-Induced Apoptosis and Anti-Proliferative Effect in Non-Small Cell Lung Cancer by Suppressing the AKT/mTOR Pathway.

Jia-Hui Rong et al.

OncoTargets and therapy, 14, 289-300 (2021-01-21)

In recent years, radioactive 125I seed implantation combined with chemotherapy has been regarded as a safe and effective treatment for advanced non-small cell lung cancer (NSCLC). However, the mechanism underlying this success is still unclear. In this study, we investigated

Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico