Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU093651

Sigma-Aldrich

MISSION® esiRNA

targeting human SUV39H2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGAGCTGTGACTTGCAGAGGTTACCTCAACTGAACTTTTTCAGGAAATAGAGCTGATGATTATAATATTTTTTTCCTAATGTTAACATTTTTAAAAATACATATTTGGGACTCTTATTATCAAGGTTCTACCTATGTTAATTTACAATTCATGTTTCAAGACATTTGCCAAATGTATTACCGATGCCTCTGAAAAGGGGGTCACTGGGTCTCATAGACTGATATGAAGTCGACATATTTATAGTGCTTAGAGACCAAACTAATGGAAGGCAGACTATTTACAGCTTAGTATATGTGTACTTAAGTCTATGTGAACAGAGAAATGCCTCCCGTAGTGTTTGAAAGCGTTAAGCTGATAATGTAATTAACAACTGCTGAGAGATCAAAGATTCAACTTGCCATACACCTCAAATTCGGAGAAACA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yue Zhang et al.
Journal of molecular cell biology, 11(9), 761-769 (2018-12-12)
X chromosome inactivation and genomic imprinting are two classic epigenetic regulatory processes that cause mono-allelic gene expression. In female mammals, mono-allelic expression of the long non-coding RNA gene X-inactive specific transcript (XIST) is essential for initiation of X chromosome inactivation
Wendi Shuai et al.
Cancer letters, 422, 56-69 (2018-02-20)
Suppressor of variegation 3-9 homolog 2 (SUV39H2) is a member of the SUV39H subfamily of lysine methyltransferases. Its role in colorectal cancer (CRC) proliferation and metastasis has remained unexplored. Here, we determined that SUV39H2 was upregulated in CRC tissues compared
Emily B Askew et al.
Molecular and cellular endocrinology, 443, 42-51 (2017-01-04)
Androgen receptor (AR) transcriptional activity depends on interactions between the AR NH
Oriane Mauger et al.
Nucleic acids research, 43(3), 1869-1882 (2015-01-22)
Alternative splicing is the main source of proteome diversity. Here, we have investigated how alternative splicing affects the function of two human histone methyltransferases (HMTase): G9A and SUV39H2. We show that exon 10 in G9A and exon 3 in SUV39H2

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico