Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU093191

Sigma-Aldrich

MISSION® esiRNA

targeting human CSNK1A1, CTB-89H12.4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTGGTGGAGAAATTGTGCATATGCCAATTTTTTGTTAAAACCTTTTGTTTTGAACTATACTGCTTTGAGATCTCATTTCAGAAGAACGGCATGAACAGTCTTCAGCCACAGTTGTGATGGTTGTTAAATGCTCACAATTGTGCATTCTTAGGGTTTTTCCATCCCTGGGGTTTGCAAGTTGTTCACTTAAAACATTCTTAAAATGGTTGGCTTCTTGTCTGCAAGCCAGCTGATATGGTAGCAACCAAAGATTCCAGTGTTTGAGCATATGAAAGACTCTGCCTGCTTAATTGTGCTAGAAATAACAGCATCTAAAGTGAAGACTTAAGAAAAACTTAGTGACTACTAGATTATCCTTAGGACTCTGCATTAACTCTATAATGTTCTTGGTATTAAAAAAAAAGCATATTTGTCACAGAAATTT

Ensembl | nº de acceso humano

ENSG00000113712

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CSNK1A1(1452) , CSNK1A1(122011)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Luke J Fulcher et al.
EMBO reports, 20(9), e47495-e47495 (2019-07-25)
The concerted action of many protein kinases helps orchestrate the error-free progression through mitosis of mammalian cells. The roles and regulation of some prominent mitotic kinases, such as cyclin-dependent kinases, are well established. However, these and other known mitotic kinases
Xia Liu et al.
Oncogene, 39(1), 176-186 (2019-08-30)
Somatic missense mutations of the CSNK1A1 gene encoding casein kinase 1 alpha (CK1α) occur in a subset of myelodysplastic syndrome (MDS) with del(5q) karyotype. The chromosomal deletion causes CSNK1A1 haplo-insufficiency. CK1α mutations have also been observed in a variety of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico