Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU092751

Sigma-Aldrich

MISSION® esiRNA

targeting human RAP1A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGATACTGCAGGGACAGAGCAATTTACAGCAATGAGGGATTTGTATATGAAGAACGGCCAAGGTTTTGCACTAGTATATTCTATTACAGCTCAGTCCACGTTTAACGACTTACAGGACCTGAGGGAACAGATTTTACGGGTTAAGGACACGGAAGATGTTCCAATGATTTTGGTTGGCAATAAATGTGACCTGGAAGATGAGCGAGTAGTTGGCAAAGAGCAGGGCCAGAATTTAGCAAGACAGTGGTGTAACTGTGCCTTTTTAGAATCTTCTGCAAAGTCAAAGATCAATGTTAATGAGATATTTTATGACCTGGTCAGACAGATAAATAGGAAAACACCAGTGGAAAAGAAGAAGCCTAAAAAGAAATCATGTCTGCTGCTCTAGGCCCATAGT

Ensembl | nº de acceso humano

ENSG00000116473

Nº de acceso NCBI

NM_001010935

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... RAP1A(5906) , RAP1A(5906)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Cuong Thach Nguyen et al.
Infection and immunity, 82(9), 3802-3810 (2014-07-02)
Caseinolytic protease L (ClpL) is a member of the HSP100/Clp chaperone family, which is found mainly in Gram-positive bacteria. ClpL is highly expressed during infection for refolding of stress-induced denatured proteins, some of which are important for adherence. However, the
Kazuya Kusama et al.
Reproduction (Cambridge, England), 147(6), 897-906 (2014-03-04)
The optimal decidualization of endometrial stromal cells (ESCs) following embryo implantation is one of the critical steps to establish pregnancy in rodents and humans. This step is intricately regulated by ovarian hormones. Using in vitro human ESCs model, we previously

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico