Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU092651

Sigma-Aldrich

MISSION® esiRNA

targeting human ACACA (1)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGAGGGTGCGTTTCAATCAGATGCTTCTGGAACGTCGAAATTGTCTTCTTTGGAAAGAACCATCCCCTCTTTGGGCTTCAGAGGCCCAAATTGAGGCGCAATGATGAGAGGATGTGGTGGTCTACTCTGATGTCAATCTTGAGGGCTAGGTCTTTCTGGAAGTGGATATCTACTCAGACAGTAAGAATTATAAGAGCTGTAAGAGCTCATTTTGGAGGAATAATGGATGAACCATCTCCCTTGGCCCAACCTCTGGAGCTGAACCAGCACTCTCGATTCATAATAGGTTCTGTGTCTGAAGATAACTCAGAGGATGAGATCAGCAACCTGGTGAAGTTGGACCTACTGGAGGAGAAGGAGGGCTCCTTGTCACCTGCTTCTGTTGG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Maosong Ye et al.
Journal of thoracic disease, 8(8), 1943-1955 (2016-09-14)
Lung cancer is the leading cause of cancer-related death worldwide. Patients with lung cancer are very frequently present with pulmonary infections, in particular with Gram-negative bacteria. Herein, we investigated the effect of the co-presence of Gram-negative bacteria on outgrowth and
Bingyu Ye et al.
Molecular medicine reports, 19(5), 3431-3440 (2019-03-01)
Acetyl‑coenzyme A carboxylase 1 (ACC1) serves a major role in fatty acid synthesis. Previous reports have indicated that ACC1 is a promising drug target for treating human diseases, particularly cancers and metabolic diseases; however, the role of ACC1 in liver
Wenjuan Li et al.
Molecular carcinogenesis, 55(11), 1739-1746 (2015-10-17)
Withaferin A (WA), a natural product derived from Withania somnifera, has been used in traditional oriental medicines to treat neurological disorders. Recent studies have demonstrated that this compound may have a potential for cancer treatment and a clinical trial has

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico