Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU092391

Sigma-Aldrich

MISSION® esiRNA

targeting human DOT1L

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTGTACGGGGAGACCTCCTTCGACCTGGTGGCCCAGATGATTGATGAGATCAAGATGACCGACGACGACCTGTTTGTGGACTTGGGGAGCGGTGTGGGCCAGGTCGTGCTCCAGGTTGCTGCTGCCACCAACTGCAAACATCACTATGGCGTCGAGAAAGCAGACATCCCGGCCAAGTATGCGGAGACCATGGACCGCGAGTTCAGGAAGTGGATGAAATGGTATGGAAAAAAGCATGCAGAATACACATTGGAGAGAGGCGATTTCCTCTCAGAAGAGTGGAGGGAGCGAATCGCCAACACGAGTGTTATATTTGTGAATAATTTTGCCTTTGGTCCTGAGGTGGATCACCAGCTGAAGGAGCGGTTTGCAAACATGAAGGAAGGTGGCAGAATCGTGTCCTCGAAACCCTTTGCACCTCTGAA

Ensembl | nº de acceso humano

ENSG00000104885

Nº de acceso NCBI

NM_032482

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... DOT1L(84444) , DOT1L(84444)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Silvia Monteagudo et al.
Nature communications, 8, 15889-15889 (2017-06-20)
Osteoarthritis is the most prevalent and crippling joint disease, and lacks curative treatment, as the underlying molecular basis is unclear. Here, we show that DOT1L, an enzyme involved in histone methylation, is a master protector of cartilage health. Loss of
Min-Hyung Cho et al.
Nature communications, 6, 7821-7821 (2015-07-23)
DOT1L has emerged as an anticancer target for MLL-associated leukaemias; however, its functional role in solid tumours is largely unknown. Here we identify that DOT1L cooperates with c-Myc and p300 acetyltransferase to epigenetically activate epithelial-mesenchymal transition (EMT) regulators in breast

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico