Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU091571

Sigma-Aldrich

MISSION® esiRNA

targeting human CADM1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGTGATGGGCAGAATCTGTTTACGAAAGACGTGACAGTGATCGAGGGAGAGGTTGCGACCATCAGTTGCCAAGTCAATAAGAGTGACGACTCTGTGATTCAGCTACTGAATCCCAACAGGCAGACCATTTATTTCAGGGACTTCAGGCCTTTGAAGGACAGCAGGTTTCAGTTGCTGAATTTTTCTAGCAGTGAACTCAAAGTATCATTGACAAACGTCTCAATTTCTGATGAAGGAAGATACTTTTGCCAGCTCTATACCGATCCCCCACAGGAAAGTTACACCACCATCACAGTCCTGGTCCCACCACGTAATCTGATGATCGATATCCAGAAAGACACTGCGGTGGAAGGTGAGGAGATTGAAGTCAACTGCACTGCTATGGCCAGCAAGCCAGCCACGACTATCAGGTGGTTCAAAGGGAAC

Ensembl | nº de acceso humano

ENSG00000182985

Nº de acceso NCBI

NM_014333

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CADM1(23705) , CADM1(23705)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Richard Hunte et al.
PLoS pathogens, 14(4), e1006968-e1006968 (2018-04-27)
Approximately 12% of all human cancers worldwide are caused by infections with oncogenic viruses. Kaposi's sarcoma herpesvirus/human herpesvirus 8 (KSHV/HHV8) is one of the oncogenic viruses responsible for human cancers, including Kaposi's sarcoma (KS), Primary Effusion Lymphoma (PEL), and the
Shu-Jun Wang et al.
Molecular medicine reports, 22(5), 3795-3803 (2020-10-02)
Melanoma is a malignant skin cancer type associated with a high mortality rate, but its treatment is currently not ideal. Both microRNA (miR)‑214 and cell adhesion molecule 1 (CADM1) are differentially expressed in melanoma, but their role in this cancer type
Hye-Ran Kim et al.
Frontiers in immunology, 11, 591054-591054 (2021-02-19)
A robust T-cell response is an important component of sustained antitumor immunity. In this respect, the avidity of TCR in the antigen-targeting of tumors is crucial for the quality of the T-cell response. This study reports that the transmembrane (TM)
Peter J Chockley et al.
The Journal of clinical investigation, 128(4), 1384-1396 (2018-01-13)
During epithelial-mesenchymal transition (EMT) epithelial cancer cells transdifferentiate into highly motile, invasive, mesenchymal-like cells, giving rise to disseminating tumor cells. Few of these disseminated cells successfully metastasize. Immune cells and inflammation in the tumor microenvironment were shown to drive EMT

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico