Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU091471

Sigma-Aldrich

MISSION® esiRNA

targeting human CPEB4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCATTCCTGCTGTTTCAAGATGAAAGCTCTGTGCAGGCTCTCATTGATGCATGCATTGAAGAAGATGGAAAACTCTACCTTTGTGTATCAAGTCCCACTATCAAGGATAAGCCAGTCCAGATTCGGCCTTGGAATCTCAGTGACAGTGACTTTGTGATGGATGGTTCACAGCCACTTGACCCACGAAAAACTATATTTGTTGGTGGTGTTCCTCGACCATTACGAGCTGTGGAGCTTGCGATGATAATGGATCGGCTATATGGAGGTGTGTGCTACGCTGGGATTGATACCGACCCTGAGCTAAAATACCCAAAAGGAGCTGGGAGAGTTGCGTTCTCTAATCAACAGAGTTACATAGCTGCTATCAGTGCCCGCTTTGTTCAGCTGCAGCATGGAGAGATAGATAAACGGGTGGAAGTTAAGCC

Ensembl | nº de acceso humano

ENSG00000113742

Nº de acceso NCBI

NM_030627

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CPEB4(80315) , CPEB4(80315)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Valeria Giangarrà et al.
PloS one, 10(9), e0138794-e0138794 (2015-09-24)
CPEB (Cytoplasmic Polyadenylation Element Binding) proteins are a family of four RNA-binding proteins that regulate the translation of maternal mRNAs controlling meiotic cell cycle progression. But CPEBs are not limited to the transcriptionally silent germline; they are also expressed, in
Weihua Huang et al.
Diagnostic pathology, 10, 127-127 (2015-07-26)
The microRNAs present a class of non-coding RNAs which are usually implicated in tumor biology. Recent report has unraveled that a novel member of microRNA family called miR-1246. However, the functional role and molecular mechanisms of miR-1246 in non-small cell
Eva Pérez-Guijarro et al.
Nature communications, 7, 13418-13418 (2016-11-20)
Nuclear 3'-end-polyadenylation is essential for the transport, stability and translation of virtually all eukaryotic mRNAs. Poly(A) tail extension can also occur in the cytoplasm, but the transcripts involved are incompletely understood, particularly in cancer. Here we identify a lineage-specific requirement

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico