Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU090781

Sigma-Aldrich

MISSION® esiRNA

targeting human MECOM (1)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCATAGATGCCAGTCAACCAGATGTTGGAAGCTGGCTCAAGTACATTAGATTCGCTGGCTGTTATGATCAGCACAACCTTGTTGCATGCCAGATAAATGATCAGATATTCTATAGAGTAGTTGCAGACATTGCGCCGGGAGAGGAGCTTCTGCTGTTCATGAAGAGCGAAGACTATCCCCATGAAACTATGGCGCCGGATATCCACGAAGAACGGCAATATCGCTGCGAAGACTGTGACCAGCTCTTTGAATCTAAGGCTGAACTAGCAGATCACCAAAAGTTTCCATGCAGTACTCCTCACTCAGCATTTTCAATGGTTGAAGAGGACTTTCAGCAAAAACTCGAAAGCGAGAATGATCTCCAAGAGATACACACGATCCAGGAGTGTAAGGAATGTGACCAAGTTTTTCCTGATTTGCAAAGCC

Ensembl | nº de acceso humano

ENSG00000085276

Nº de acceso NCBI

NM_005241

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MECOM(2122) , EVI1(2122)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lai-Sheung Chan et al.
International journal of molecular sciences, 21(15) (2020-08-06)
The Wnt signaling pathway is one of the major signaling pathways used by cancer stem cells (CSC). Ecotropic Viral Integration Site 1 (EVI1) has recently been shown to regulate oncogenic development of tumor cells by interacting with multiple signaling pathways
Anjan Kumar Pradhan et al.
PloS one, 6(9), e25370-e25370 (2011-10-08)
EVI1 (Ecotropic Viral Integration site I), which was originally identified as a myeloid transforming gene by means of retroviral insertional mutagenesis in mouse leukemia, encodes a nuclear DNA binding zinc finger protein. The presence of zinc fingers that are able
F Mateo et al.
Oncogene, 36(19), 2737-2749 (2016-12-20)
Inhibitors of the mechanistic target of rapamycin (mTOR) are currently used to treat advanced metastatic breast cancer. However, whether an aggressive phenotype is sustained through adaptation or resistance to mTOR inhibition remains unknown. Here, complementary studies in human tumors, cancer
Gerwin Heller et al.
Journal of hematology & oncology, 8, 28-28 (2015-04-18)
The transcription factor Ecotropic Virus Integration site 1 (EVI1) regulates cellular proliferation, differentiation, and apoptosis, and its overexpression contributes to an aggressive course of disease in myeloid leukemias and other malignancies. Notwithstanding, knowledge about the target genes mediating its biological

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico