Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU090201

Sigma-Aldrich

MISSION® esiRNA

targeting human KANK1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACCTCCGTGGAAACAAACAGTGTAGGCATCTCCTGCCAGCCTGAATGTAAGAATAAAGTCGTAGGGCCTGAGCTGCCTATGAATTGGTGGATTGTTAAGGAGAGGGTGGAAATGCATGACCGATGTGCTGGGAGGTCTGTGGAAATGTGTGACAAGAGTGTGAGTGTGGAAGTCAGCGTCTGCGAAACAGGCAGCAACACAGAGGAGTCTGTGAACGACCTCACACTCCTCAAGACAAACTTGAATCTCAAAGAAGTGCGGTCTATCGGTTGTGGAGATTGTTCTGTTGACGTGACCGTCTGCTCTCCAAAGGAGTGCGCCTCCCGGGGCGTGAACACTGAGGCTGTTAGCCAGGTGGAAGCTGCCGTCATGGCAGTGCCTCGTACTGCAGACCAGGACACTAGCACAGATTTGGAACAGGTGCACC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhibin Cui et al.
Scientific reports, 7, 40325-40325 (2017-01-10)
Malignant peripheral nerve sheath tumors (MPNSTs) are a type of rare sarcomas with a poor prognosis due to its highly invasive nature and limited treatment options. Currently there is no targeted-cancer therapy for this type of malignancy. Thus, it is
Nisha Bte Mohd Rafiq et al.
Nature materials, 18(6), 638-649 (2019-05-23)
The interrelationship between microtubules and the actin cytoskeleton in mechanoregulation of integrin-mediated adhesions is poorly understood. Here, we show that the effects of microtubules on two major types of cell-matrix adhesion, focal adhesions and podosomes, are mediated by KANK family

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico