Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU090121

Sigma-Aldrich

MISSION® esiRNA

targeting human AGTR1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GATTGTCCCAAAGCTGGAAGGCATAATTACATATTTGTCATGATTCCTACTTTATACAGTATCATCTTTGTGGTGGGAATATTTGGAAACAGCTTGGTGGTGATAGTCATTTACTTTTATATGAAGCTGAAGACTGTGGCCAGTGTTTTTCTTTTGAATTTAGCACTGGCTGACTTATGCTTTTTACTGACTTTGCCACTATGGGCTGTCTACACAGCTATGGAATACCGCTGGCCCTTTGGCAATTACCTATGTAAGATTGCTTCAGCCAGCGTCAGTTTCAACCTGTACGCTAGTGTGTTTCTACTCACGTGTCTCAGCATTGATCGATACCTGGCTATTGTTCACCCAATGAAGTCCCGCCTTCGACGCACAATGCTTGTAGCCAAAGTCACCTGCA

Ensembl | nº de acceso humano

ENSG00000144891

Nº de acceso NCBI

NM_000685

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... AGTR1(185) , AGTR1(185)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhimin Zhang et al.
Experimental and therapeutic medicine, 20(4), 3269-3277 (2020-08-29)
Endometriosis (EM) is a common disease in women; however, the signaling pathways and related genes underlying the mechanisms of EM remain unclear. The present study aimed to investigate the role of angiotensin II receptor type 1 (AGTR1) in the pathogenesis
Alexander Renziehausen et al.
Oncogene, 38(13), 2320-2336 (2018-11-28)
Despite emergence of new systemic therapies, metastatic melanoma remains a challenging and often fatal form of skin cancer. The renin-angiotensin system (RAS) is a major physiological regulatory pathway controlling salt-water equilibrium, intravascular volume and blood pressure. Biological effects of the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico