Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU089121

Sigma-Aldrich

MISSION® esiRNA

targeting human TNIK

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGTGGGCAAGGCAAAGTCTATAATCTGATCAACCGGAGGCGATTTCAGCAGATGGATGTGCTAGAGGGACTGAATGTCCTTGTGACAATTTCAGGAAAGAAGAATAAGCTACGAGTTTACTATCTTTCATGGTTAAGAAACAGAATACTACATAATGACCCAGAAGTAGAAAAGAAACAAGGCTGGATCACTGTTGGGGACTTGGAAGGCTGTATACATTATAAAGTTGTTAAATATGAAAGGATCAAATTTTTGGTGATTGCCTTAAAGAATGCTGTGGAAATATATGCTTGGGCTCCTAAACCGTATCATAAATTCATGGCATTTAAGTCTTTTGCAGATCTCCAGCACAAGCCTCTGCTAGTTGATCTCACGGTAGAAGAAGGTCAAAGATTAAAGGTTATTTTTGGTTCACACACTGGTTTCCA

Ensembl | nº de acceso humano

ENSG00000154310

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TNIK(23043) , TNIK(23043)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kyeong-Yong Park et al.
PloS one, 15(8), e0232917-e0232917 (2020-08-19)
In human lung cancer progression, the EMT process is characterized by the transformation of cancer cells into invasive forms that migrate to other organs. Targeting to EMT-related molecules is emerging as a novel therapeutic approach for the prevention of lung
Martin Larhammar et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 37(46), 11074-11084 (2017-10-11)
The c-Jun-N-terminal kinase (JNK) signaling pathway regulates nervous system development, axon regeneration, and neuronal degeneration after acute injury or in chronic neurodegenerative disease. Dual leucine zipper kinase (DLK) is required for stress-induced JNK signaling in neurons, yet the factors that

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico