Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU086641

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC12A9

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGAACACACTGGCTGCTGTGGTCACTGTCTTCTACCTGGTGGCCTATGCTGCCGTGGACCTGTCCTGCCTGAGCCTGGAGTGGGCCTCGGCCCCCAACTTCCGCCCCACCTTCAGCCTGTTCTCCTGGCACACCTGCCTGCTGGGGGTGGCCTCCTGCCTGCTCATGATGTTCCTCATCAGTCCTGGCGCGGCTGGTGGCTCCCTGCTCCTCATGGGTCTGCTGGCTGCCCTGCTCACCGCGCGAGGAGGCCCCAGTAGCTGGGGCTATGTCAGCCAGGCCTTGCTTTTCCACCAGGTGCGTAAGTATCTGCTTCGGCTGGACGTCCGGAAGGATCACGTGAAGTTCTGGCGGCCCCAGCTGCTGCTCCTGGTGGGGAACCCCCGGGGCGCCCTGCCTCTGCTGCGGTTGGCCAACCAGCTTAAGAAGGGG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Anna E Vilgelm et al.
EBioMedicine, 24, 43-55 (2017-10-17)
Antagonists of MDM2-p53 interaction are emerging anti-cancer drugs utilized in clinical trials for malignancies that rarely mutate p53, including melanoma. We discovered that MDM2-p53 antagonists protect DNA from drug-induced damage in melanoma cells and patient-derived xenografts. Among the tested DNA
Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle
S Kagawa et al.
Oncogene, 34(18), 2347-2359 (2014-06-17)
Notch activity regulates tumor biology in a context-dependent and complex manner. Notch may act as an oncogene or a tumor-suppressor gene even within the same tumor type. Recently, Notch signaling has been implicated in cellular senescence. Yet, it remains unclear

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico