Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU085731

Sigma-Aldrich

MISSION® esiRNA

targeting human MKNK2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCTGGCCTTCTCCCTAGACCAGCCCGACCACGGAGACTCTGACTTTGGCCTGCAGTGCTCAGCCCGCCCTGACATGCCCGCCAGCCAGCCCATTGACATCCCGGACGCCAAGAAGAGGGGCAAGAAGAAGAAGCGCGGCCGGGCCACCGACAGCTTCTCGGGCAGGTTTGAAGACGTCTACCAGCTGCAGGAAGATGTGCTGGGGGAGGGCGCTCATGCCCGAGTGCAGACCTGCATCAACCTGATCACCAGCCAGGAGTACGCCGTCAAGATCATTGAGAAGCAGCCAGGCCACATTCGGAGCAGGGTTTTCAGGGAGGTGGAGATGCTGTACCAGTGCCAGGGACACAGGAACGTCCTAGAGCTGATTGAGTTCTTCGAGGAGGAGGACCGCTTCTAC

Ensembl | nº de acceso humano

ENSG00000099875

Nº de acceso NCBI

NM_017572

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MKNK2(2872) , MKNK2(2872)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jonathan B Bell et al.
Molecular cancer research : MCR, 16(1), 32-46 (2017-10-19)
Mesenchymal (MES) and proneural (PN) are two distinct glioma stem cell (GSC) populations that drive therapeutic resistance in glioblastoma (GBM). We screened a panel of 650 small molecules against patient-derived GBM cells to discover compounds targeting specific GBM subtypes. Arsenic
Zhihua Guo et al.
Scientific reports, 7(1), 10612-10612 (2017-09-08)
We hypothesized that MAP kinase-interacting serine/threonine kinase 2 (MNK2) may contribute to non-small cell lung cancer (NSCLC) development, and serve as a new therapeutic target. Immunohistochemical staining evaluated the correlation between MNK2 expression and clinicopathological features in 367 NSCLC cancer

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico