Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU085631

Sigma-Aldrich

MISSION® esiRNA

targeting human GNL3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGCCATCAAATGTGGAACCTATGGAAAAGGAGTTTGGGCTTTGCAAAACTGAGAACAAAGCCAAGTCGGGCAAACAGAATTCAAAGAAGCTGTACTGCCAAGAACTTAAAAAGGTGATTGAAGCCTCCGATGTTGTCCTAGAGGTGTTGGATGCCAGAGATCCTCTTGGTTGCAGATGTCCTCAGGTAGAAGAGGCCATTGTCCAGAGTGGACAGAAAAAGCTGGTACTTATATTAAATAAATCAGATCTGGTACCAAAGGAGAATTTGGAGAGCTGGCTAAATTATTTGAAGAAAGAATTGCCAACAGTGGTGTTCAGAGCCTCAACAAAACCAAAGGATAAAGGGAAGATAACCAAGCGTGTGAAGGCAAAGAAGAATGCTGCTCCATTCAGAAGTGAAGTCTGCTTTGGGAAAGAGGGCCTTTGGAAAC

Ensembl | nº de acceso humano

ENSG00000163938

Nº de acceso NCBI

NM_014366

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... GNL3(26354) , GNL3(26354)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mei-Hong Li et al.
Journal of pediatric surgery, 49(8), 1286-1291 (2014-08-06)
Neuroblastoma (NB) is the most common extracranial solid tumor of childhood. Preliminary data derived from a human angiogenesis array in NB showed that the bioactive lipid sphingosine-1-phosphate (S1P) induced the secretion of several angiogenesis-related proteins including the important inflammatory factor
Tengwei Cao et al.
PloS one, 9(8), e103793-e103793 (2014-08-08)
Atrial hypertrophy and fibrosis are essential pathological features of atrial fibrillation. Recently, adiponectin has become a protein of interest due to its beneficial effects on cardiovascular diseases. However, the molecular mechanism of atrial structural remodeling and signaling pathways evoked by
Zhihong Yuan et al.
PloS one, 9(5), e94241-e94241 (2014-05-21)
It is increasingly recognized that the tumor microenvironment plays a critical role in the initiation and progression of lung cancer. In particular interaction of cancer cells, macrophages, and inflammatory response in the tumor microenvironment has been shown to facilitate cancer
Junyue Xing et al.
Molecular and cellular biology, 35(23), 4043-4052 (2015-09-24)
The tRNA methytransferase NSun2 promotes cell proliferation, but the molecular mechanism has not been elucidated. Here, we report that NSun2 regulates cyclin-dependent kinase 1 (CDK1) expression in a cell cycle-dependent manner. Knockdown of NSun2 decreased the CDK1 protein level, while

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico