Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU085291

Sigma-Aldrich

MISSION® esiRNA

targeting human JMJD6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTTTGTTGAATGCGCAAGAGGGCTGGTCTGCGCAGGAGAAATGGACTCTGGAGCGCCTAAAAAGGAAATATCGGAACCAGAAGTTCAAGTGTGGTGAGGATAACGATGGCTACTCAGTGAAGATGAAGATGAAATACTACATCGAGTACATGGAGAGCACTCGAGATGATAGTCCCCTTTACATCTTTGACAGCAGCTATGGTGAACACCCTAAAAGAAGGAAACTTTTGGAAGACTACAAGGTGCCAAAGTTTTTCACTGATGACCTTTTCCAGTATGCTGGGGAGAAGCGCAGGCCCCCTTACAGGTGGTTTGTGATGGGGCCACCACGCTCCGGAACTGGGATTCACATCGACCCTCTGGGAACCAGTGCCTGGAATGCCTTAGTTCAGGGCCACAAGC

Ensembl | nº de acceso humano

ENSG00000070495

Nº de acceso NCBI

NM_015167

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... JMJD6(23210) , JMJD6(23210)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chang-Ryul Lee et al.
Carcinogenesis, 37(2), 119-128 (2015-12-10)
Cancer stem cells (CSCs) are defined as a small subpopulation of cancer cells within a tumor and responsible for initiation and maintenance of tumor growth. Thus, understanding of molecular regulators of CSCs is of paramount importance for the development of
Alec Paschalis et al.
Cancer research, 81(4), 1087-1100 (2021-04-07)
Endocrine resistance (EnR) in advanced prostate cancer is fatal. EnR can be mediated by androgen receptor (AR) splice variants, with AR splice variant 7 (AR-V7) arguably the most clinically important variant. In this study, we determined proteins key to generating
Yan Liu et al.
Oncogene, 38(7), 980-997 (2018-09-07)
Overexpression of Jumonji domain-containing 6 (JMJD6) has been reported to be associated with more aggressive breast cancer characteristics. However, the precise role of JMJD6 in breast cancer development remains unclear. Here, we demonstrate that JMJD6 has intrinsic tyrosine kinase activity

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico