Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU081441

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK14

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TATTTGGGCCAAGGTGTTTCCATTTCTCAATCAGTGCAGTGATACATGTACTCCAGAGGGACAGGGTGGACCCCCTGAGTCAACTGGAGCAAGAAGGAAGGAGGCAGACTGATGGCGATTCCCTCTCACCCGGGACTCTCCCCCTTTCAAGGAAAGTGAACCTTTAAAGTAAAGGCCTCATCTCCTTTATTGCAGTTCAAATCCTCACCATCCACAGCAAGATGAATTTTATCAGCCATGTTTGGTTGTAAATGCTCGTGTGATTTCCTACAGAAATACTGCTCTGAATATTTTGTAATAAAGGTCTTTGCACATGTGACCACATACGTGTTAGGAGGCTGCATGCTCTGGAAGCCTGGACTCTAAGCTGGAGCTCTTGGAAGAGCTCTTCGGTTTCTGAGCAT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wan-Juan Song et al.
Pathology, research and practice, 213(10), 1282-1288 (2017-09-17)
This study was to identify the biomarkers for the malignancy and poor prognosis in patients with ovarian cancer. The protein expression of p38MAPK family isoform p38α (p38α) and activating transcription factor 2 (ATF2) was measured in 120 ovarian serous adenocarcinomas
Yumei Yan et al.
Scientific reports, 6, 37052-37052 (2016-11-16)
Hepatocellular carcinoma (HCC) is refractory to chemotherapies, necessitating novel effective agents. The lysosome inhibitor Bafilomycin A1 (BafA1) at high concentrations displays cytotoxicity in a variety of cancers. Here we show that BafA1 at nanomolar concentrations suppresses HCC cell growth in
Y Kim et al.
The British journal of dermatology, 179(3), 689-701 (2018-02-28)
Adiponectin is an adipocyte-derived cytokine that circulates as a full-length protein and a fragment containing the globular domain of adiponectin (gAd). A recent study has reported the antimelanogenic effects of full-length adiponectin. To examine the involvement of gAd in melanogenesis
Zhe Zhang et al.
Virology, 508, 150-158 (2017-05-26)
Enterovirus71 (EV71) is the major causative agent of hand, foot and mouth disease, which threatens the health of infants and young children. The expression of inflammatory cytokines induced by this viral infection aggravate the illness. Here, we describe the anti-EV71
Yu Wang et al.
Oncology reports, 39(1), 61-70 (2017-11-09)
Photodynamic therapy (PDT) is considered to be an advancing antitumor technology. PDT using hydrophilic/lipophilic tetra‑α-(4-carboxyphenoxy) phthalocyanine zinc (TαPcZn-PDT) has exhibited antitumor activity in Bel-7402 hepatocellular cancer cells. However, the manner in which p38 MAPK and caspase-9 are involved in the regulation

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico