Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU081311

Sigma-Aldrich

MISSION® esiRNA

targeting human NEIL1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCCTATGTTTCGTGGACATCCGCCGGTTCGGCCGCTGGGACCTTGGGGGAAAGTGGCAGCCGGGCCGCGGGCCCTGTGTCTTGCAGGAGTACCAGCAGTTCAGGGAGAATGTGCTACGAAACCTAGCGGATAAGGCCTTTGACCGGCCCATCTGCGAGGCCCTCCTGGACCAGAGGTTCTTCAATGGCATTGGCAACTATCTGCGGGCAGAGATCCTGTACCGGCTGAAGATCCCCCCCTTTGAGAAGGCCCGCTCGGTCCTGGAGGCCCTGCAGCAGCACAGGCCGAGCCCGGAGCTGACCCTGAGCCAGAAGATAAGGACCAAGCTGCAGAATCCAGACCTGCTGGAGCTATGTCACTCAGTGCCCAAGGAAGTGGTCCAGTTGGGGGGCAAAGGCTACGGGTCAGAGAGCGGGGAGGAGGACTTTGCTGCCTTT

Ensembl | nº de acceso humano

ENSG00000140398

Nº de acceso NCBI

NM_024608

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NEIL1(79661) , NEIL1(79661)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wanjuan Xue et al.
BioMed research international, 2020, 5053975-5053975 (2020-07-21)
The study is aimed at investigating the role of Nei endonuclease VIII-like1 (NEIL1) in the pathogenesis of colorectal cancer (CRC). The human CRC (HCT116 and SW480) cells were subjected to the siRNA silencing and recombinant plasmid overexpression of NEIL1. Transfection
Shiladitya Sengupta et al.
DNA repair, 66-67, 1-10 (2018-04-27)
Posttranslational modifications of DNA repair proteins have been linked to their function. However, it is not clear if posttranslational acetylation affects subcellular localization of these enzymes. Here, we show that the human DNA glycosylase NEIL1, which is involved in repair

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico