Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU079631

Sigma-Aldrich

MISSION® esiRNA

targeting human C1QA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGTCATCACCAACCAGGAAGAACCGTACCAGAACCACTCCGGCCGATTCGTCTGCACTGTACCCGGCTACTACTACTTCACCTTCCAGGTGCTGTCCCAGTGGGAAATCTGCCTGTCCATCGTCTCCTCCTCAAGGGGCCAGGTCCGACGCTCCCTGGGCTTCTGTGACACCACCAACAAGGGGCTCTTCCAGGTGGTGTCAGGGGGCATGGTGCTTCAGCTGCAGCAGGGTGACCAGGTCTGGGTTGAAAAAGACCCCAAAAAGGGTCACATTTACCAGGGCTCTGAGGCCGACAGCGTCTTCAGCGGCTTCCTCATCTTCCCATCTGCCTGAGCCAGGGAAGGACCCCCTCCCCCACCCACCTCTCTGGCTTCCATGCTCCGCCTGTAAAATGGGGGCGCTAT

Ensembl | nº de acceso humano

ENSG00000173372

Nº de acceso NCBI

NM_015991

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... C1QA(712) , C1QA(712)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaoyi Yuan et al.
JCI insight, 5 (2019-05-22)
Alteration of innate immune cells in the lungs can promote loss of peripheral tolerance that leads to autoimmune responses in cigarette smokers. Development of autoimmunity in smokers with emphysema is also strongly linked to the expansion of autoreactive T helper
Sarah Fox et al.
Journal of inflammation (London, England), 12, 51-51 (2015-09-12)
Gastric epithelial cells (GECs) undergo apoptosis during H. pylori infection and phagocytes within the mucosa engulf these cells. The recognition and clearance of apoptotic cells is a multifactorial process, enhanced by the presence of various bridging molecules and opsonins which

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico