Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU079431

Sigma-Aldrich

MISSION® esiRNA

targeting human IL9R

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTCCCTTCTGTCCTCAGCAAGGCTCGGTCCTGGACATTCTAGGTCCCTGACTCGCCAGATGCATCATGTCCATTTTGGGAAAATGGACTGAAGTTTCTGGAGCCCTTGTCTGAGACTGAACCTCCTGAGAAGGGGCCCCTAGCAGCGGTCAGAGGTCCTGTCTGGATGGAGGCTGGAGGCTCCCCCCTCAACCCCTCTGCTCAGTGCCTGTGGGGAGCAGCCTCTACCCTCAGCATCCTGGCCACAAGTTCTTCCTTCCATTGTCCCTTTTCTTTATCCCTGACCTCTCTGAGAAGTGGGGTGTGGTCTCTCAGCTGTTCTGCCCTCATACCCTTAAAGGGCCAGCCTGGGCCCAGTGGACACAGGTAAGGCACCATGACCACCTGGTGTGACCTCTCTGTGCCT

Ensembl | nº de acceso humano

ENSG00000124334

Nº de acceso NCBI

NM_002186

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IL9R(3581) , IL9R(3581)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Min Xiao et al.
Blood, 129(24), 3196-3209 (2017-04-30)
Severe thrombocytopenia is a significant challenge in patients undergoing myelosuppressive chemotherapy for malignancies. Understanding the biology of platelet-producing megakaryocytes development in the bone marrow microenvironment may facilitate the development of novel therapies to stimulate platelet production and prevent thrombocytopenia. We
Hong-Jun Li et al.
Oncology reports, 34(2), 795-802 (2015-06-18)
Interleukin-9 receptor (IL-9R) overexpression has a pivotal role in human hematological malignancies. However, the expression of IL-9R and its biological role in human solid tumors remains elusive. In the present study, western blot analysis and RT-qPCR were used to determine

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico