Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU078761

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPM4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGCCTGGAGTCCTACATCTCACAGCAGAAGACGGGCGTGGGAGGGACTGGAATTGACATCCCTGTCCTGCTCCTCCTGATTGATGGTGATGAGAAGATGTTGACGCGAATAGAGAACGCCACCCAGGCTCAGCTCCCATGTCTCCTCGTGGCTGGCTCAGGGGGAGCTGCGGACTGCCTGGCGGAGACCCTGGAAGACACTCTGGCCCCAGGGAGTGGGGGAGCCAGGCAAGGCGAAGCCCGAGATCGAATCAGGCGTTTCTTTCCCAAAGGGGACCTTGAGGTCCTGCAGGCCCAGGTGGAGAGGATTATGACCCGGAAGGAGCTCCTGACAGTCTATTCTTCTGAGGATGGGTCTGAGGAATTCGAGACCATAGTTTTGAAGGCCCTTGTGAAGGCCTGTGGGAGCTCGGAGGCCTCAGCCTACCTGGATGAGCTGCGTT

Ensembl | nº de acceso humano

ENSG00000130529

Nº de acceso NCBI

NM_017636

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TRPM4(54795) , TRPM4(54795)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xi Hong et al.
American journal of physiology. Cell physiology, 316(4), C463-C480 (2018-12-20)
Prostate cancer (PCa) remains one of the leading causes of cancer-related deaths among males. The aim of the current study was to investigate the ability of microRNA-150 (miR-150) targeting transient receptor potential melastatin 4 (TRPM4) to mediate epithelial-mesenchymal transition (EMT)
Fujue Wang et al.
Cellular signalling, 72, 109643-109643 (2020-04-23)
Transient Receptor Potential Melastatin Subfamily Member 4 (TRPM4) has been demonstrated to be aberrantly expressed in several cancers but seldom reported in acute leukemia. Based on database mining and validated experiments, our present data show that TRPM4 is selectively overexpressed
Elías Leiva-Salcedo et al.
Channels (Austin, Tex.), 11(6), 624-635 (2017-09-07)
Cerebral ischemia-reperfusion injury triggers a deleterious process ending in neuronal death. This process has two components, a glutamate-dependent and a glutamate-independent mechanism. In the glutamate-independent mechanism, neurons undergo a slow depolarization eventually leading to neuronal death. However, little is known
Chun-Xiao Yu et al.
Toxicology letters, 312, 98-108 (2019-05-06)
To investigate the effect of Arsenic Trioxide (ATO) on endothelial cells injury and explore the role of transient receptor potential melastatin 4 channel (TRPM4) in ATO-induced endothelial injury. qRT-PCR was used to examine the mRNA expression of TRPM4 in human
Christian Holzmann et al.
Oncotarget, 6(39), 41783-41793 (2015-10-27)
Impaired Ca2+ signaling in prostate cancer contributes to several cancer hallmarks, such as enhanced proliferation and migration and a decreased ability to induce apoptosis. Na+ influx via transient receptor potential melastatin 4 channel (TRPM4) can reduce store-operated Ca2+ entry (SOCE)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico