Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU077551

Sigma-Aldrich

MISSION® esiRNA

targeting human USP2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTTCGCTTTCTTCTGGATGGGCTCCATAACGAGGTGAACCGAGTGACACTGAGACCTAAGTCCAACCCTGAGAACCTCGATCATCTTCCTGATGACGAGAAAGGCCGACAGATGTGGAGAAAATATCTAGAACGGGAAGACAGTAGGATCGGGGATCTCTTTGTTGGGCAGCTAAAGAGCTCGCTGACGTGTACAGATTGTGGTTACTGTTCTACGGTCTTCGACCCCTTCTGGGACCTCTCACTGCCCATTGCTAAGCGAGGTTATCCTGAGGTGACATTAATGGACTGCATGAGGCTCTTCACCAAAGAGGATGTGCTTGATGGAGATGAAAAGCCAACATGCTGTCGCTGCCGAGGCAGAAAACGGTGTATAAAGAAGTTCTCCATCCAGAGGTTCCCAAAGA

Ensembl | nº de acceso humano

ENSG00000036672

Nº de acceso NCBI

NM_171997

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... USP2(9099) , USP2(9099)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wei Chen et al.
Biomaterials, 192, 590-600 (2018-12-16)
Pancreatic ductal adenocarcinoma (PDAC) is a destructive cancer with poor prognosis. Both novel therapeutic targets and approaches are needed to improve the overall survival of PDAC patients. MicroRNA-212 (miR-212) has been reported as a tumor suppressor in multiple cancers, but
B Wang et al.
Cell death and differentiation, 21(7), 1160-1169 (2014-04-29)
Mcl-1 is a unique antiapoptotic Bcl2 family member with a short half-life due to its rapid turnover through ubiquitination. We discovered that Ku70, a DNA double-strand break repair protein, functions as a deubiquitinase to stabilize Mcl-1. Ku70 knockout in mouse

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico