Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU077201

Sigma-Aldrich

MISSION® esiRNA

targeting human OPTN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGGCTCCTCAGAAGATTCCTTTGTTGAAATTAGGATGGCTGAAGGAGAAGCAGAAGGGTCAGTAAAAGAAATCAAGCATAGTCCTGGGCCCACGAGAACAGTCTCCACTGGCACGGCATTGTCTAAATATAGGAGCAGATCTGCAGATGGGGCCAAGAATTACTTCGAACATGAGGAGTTAACTGTGAGCCAGCTCCTGCTGTGCCTAAGGGAAGGGAATCAGAAGGTGGAGAGACTTGAAGTTGCACTCAAGGAGGCCAAAGAAAGAGTTTCAGATTTTGAAAAGAAAACAAGTAATCGTTCTGAGATTGAAACCCAGACAGAGGGGAGCACAGAGAAAGAGAATGATGAAGAGAAAGGCCCGGAGACTGTTGGAAGCGAAGTGGAAGCACTGAACCTCCAGGTG

Ensembl | nº de acceso humano

ENSG00000123240

Nº de acceso NCBI

NM_021980

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... OPTN(10133) , OPTN(10133)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kehong Chen et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(3), 4571-4585 (2018-12-21)
Tubulointerstitial inflammation plays a critical role in the progression of diabetic nephropathy (DN), and nucleotide-binding oligomerization domain-like receptor family pyrin domain-containing 3 (NLRP3) inflammasomes contribute to renal interstitial inflammation in DN. Decreased expression of optineurin (OPTN) is also associated with
Astrid Skjesol et al.
PLoS pathogens, 15(3), e1007684-e1007684 (2019-03-19)
Phagocytosis is a complex process that eliminates microbes and is performed by specialised cells such as macrophages. Toll-like receptor 4 (TLR4) is expressed on the surface of macrophages and recognizes Gram-negative bacteria. Moreover, TLR4 has been suggested to play a
Vinod Sundaramoorthy et al.
Human molecular genetics, 24(13), 3830-3846 (2015-04-11)
Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder primarily affecting motor neurons. Mutations in optineurin cause a small proportion of familial ALS cases, and wild-type (WT) optineurin is misfolded and forms inclusions in sporadic ALS patient motor neurons. However

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico