Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU076361

Sigma-Aldrich

MISSION® esiRNA

targeting human ATG16L1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGGGTTCCCTATCTGGCAGTAATGCAGGAATTACAAGCATTGAATTTGATAGTGCTGGATCTTACCTCTTAGCAGCTTCAAATGATTTTGCAAGCCGAATCTGGACTGTGGATGATTATCGATTACGGCACACACTCACGGGACACAGTGGGAAAGTGCTGTCTGCTAAGTTCCTGCTGGACAATGCGCGGATTGTCTCAGGAAGTCACGACCGGACTCTCAAACTCTGGGATCTACGCAGCAAAGTCTGCATAAAGACAGTGTTTGCAGGATCCAGTTGCAATGATATTGTCTGCACAGAGCAATGTGTAATGAGTGGACATTTTGACAAGAAAATTCGTTTCTGGGACATTCGATCAGAGAGCATAGTTCGAGAGATGGAGCTGTTGGGAAAGATTACTGCCCTGGACTTAAACCCAGAAAGGACTGAGCTCCTGAGCTGCT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Marek J Kobylarz et al.
PloS one, 15(8), e0235551-e0235551 (2020-08-25)
VPS34 is a key regulator of endomembrane dynamics and cargo trafficking, and is essential in cultured cell lines and in mice. To better characterize the role of VPS34 in cell growth, we performed unbiased cell line profiling studies with the
Yasuomi Urano et al.
Autophagy, 14(11), 1943-1958 (2018-08-17)
PARK7/DJ-1 is a Parkinson disease- and cancer-associated protein that functions as a multifunctional protein involved in gene transcription regulation and anti-oxidative defense. Although PARK7 lacks the secretory signal sequence, it is secreted and plays important physiological and pathophysiological roles. Whereas

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico