Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU076021

Sigma-Aldrich

MISSION® esiRNA

targeting human SPAG9

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTGGTTCTGTTGTTGGAGCAAGTGTATTTTACAAGGATGTTGCTGGTTTGGATACAGAAGGCAGTAAACAGCGAAGTGCCTCTCAGAGTAGTTTAGATAAGTTAGATCAGGAACTTAAGGAACAGCAGAAGGAGTTAAAAAATCAAGAAGAATTATCCAGTCTAGTTTGGATCTGTACCAGCACTCATTCGGCTACAAAAGTTCTTATTATTGATGCTGTTCAACCTGGCAACATCCTAGACAGTTTCACTGTTTGCAACTCTCATGTTCTGTGCATTGCAAGTGTGCCAGGTGCACGAGAAACAGACTACCCTGCAGGAGAAGATCTTTCAGAATCTGGTCAGGTAGACAAAGCATCTTTATGTGGAAGTATGACAAGCAACAGCTCAGCAGAGACAGACAGCCTG

Ensembl | nº de acceso humano

ENSG00000008294

Nº de acceso NCBI

NM_003971

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SPAG9(9043) , SPAG9(9043)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qin Hui Sun et al.
BMC cancer, 20(1), 522-522 (2020-06-07)
microRNAs (miRNAs) play essential roles in the development and progression of gastric cancer (GC). Although aberrant miR-874 expression has been reported in various human cancers, its role in GC remains obscure. miR-874 expression was assessed by real-time quantitative polymerase chain
Hui Li et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(7), 6949-6954 (2014-04-18)
Sperm-associated antigen 9 (SPAG9) was recently reported to be overexpressed in several cancers and associated with the malignant behavior of cancer cells. However, the expression pattern of SPAG9 and its clinical significance in human prostate cancer have not been reported.
Zhi-Feng Miao et al.
Virchows Archiv : an international journal of pathology, 467(5), 525-533 (2015-08-22)
Sperm associated antigen 9 (SPAG9) protein has been found to play an important role in cancer progression but the involved mechanisms are still obscure. Its clinical significance in human gastric cancers remains unexplored. In the present study, SPAG9 expression was
Feifei Chen et al.
Oncology reports, 32(6), 2533-2540 (2014-10-14)
Sperm-associated antigen 9 (SPAG9) is a recently characterized oncoprotein involved in the progression of several human malignancies. To elucidate the role of SPAG9 in the development of human prostate cancer (PCa), tissue microarray (TMA) and immunohistochemistry were used to detect
Luis Bonet-Ponce et al.
Science advances, 6(46) (2020-11-13)
Genetic variation around the LRRK2 gene affects risk of both familial and sporadic Parkinson's disease (PD). However, the biological functions of LRRK2 remain incompletely understood. Here, we report that LRRK2 is recruited to lysosomes after exposure of cells to the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico