Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU075421

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAAGGCATTGGTGAAGACAAAATGGCCTCGCCGGCTGACAGCTGTATCCAGTTCACCCGCCATGCCAGTGATGTTCTTCTCAACCTTAATCGTCTCCGGAGTCGAGACATCTTGACTGATGTTGTCATTGTTGTGAGCCGTGAGCAGTTTAGAGCCCATAAAACGGTCCTCATGGCCTGCAGTGGCCTGTTCTATAGCATCTTTACAGACCAGTTGAAATGCAACCTTAGTGTGATCAATCTAGATCCTGAGATCAACCCTGAGGGATTCTGCATCCTCCTGGACTTCATGTACACATCTCGGCTCAATTTGCGGGAGGGCAACATCATGGCTGTGATGGCCACGGCTATGTACCTGCAGATGGAGCATGTTGTGGACACTTGCCGGAAGTTTATTAAGGCCAGTGAAGCAGAGATGGTTTCTGCCATCAAGCCTCCTCGTGAAGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Marie-Sophie Fabre et al.
PloS one, 15(4), e0231470-e0231470 (2020-04-23)
The prognosis for people with the high-grade brain tumor glioblastoma is very poor, due largely to low cell death in response to genotoxic therapy. The transcription factor BCL6, a protein that normally suppresses the DNA damage response during immune cell
Britta Jasmer et al.
Oncotarget, 8(65), 108643-108654 (2018-01-10)
The oncogene B-cell lymphoma 6 (BCL6) is associated with lymphomagenesis. Intriguingly, its expression is increased in preeclamptic placentas. Preeclampsia is one of the leading causes of maternal and perinatal mortality and morbidity. Preeclamptic placentas are characterized by various defects like
Min Gao et al.
Aging, 12(10), 9275-9291 (2020-05-16)
Nucleus accumbens-associated protein 1 (NAC1) has multifaceted roles in cancer pathogenesis and progression, including the development of drug resistance, promotion of cytokinesis, and maintenance of "stem cell-like" phenotypes. NAC1 is a transcriptional co-regulator belonging to the bric-a-brac tramtrack broad (BTB)
Lu Gao et al.
Biochimica et biophysica acta. Molecular basis of disease, 1864(10), 3322-3338 (2018-07-22)
Diabetes contributes to cardiovascular complications and the pathogenesis of cardiac remodeling that can lead to heart failure. We aimed to evaluate the functional role of LAZ3 in diabetic cardiomyopathy (DCM). Streptozotocin (STZ) was used to induce a diabetic mouse model.
Siraj M El Jamal et al.
Laboratory investigation; a journal of technical methods and pathology, 99(4), 539-550 (2018-11-18)
Myocyte enhancer-binding factor 2B (MEF2B) has been implicated as a transcriptional regulator for BCL6. However, details about the interaction between MEF2B and BCL6 during expression, as well as the relationship of MEF2B to the expression of other germinal center (GC)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico