Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU075391

Sigma-Aldrich

MISSION® esiRNA

targeting human GREM1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGCGAGACTGGTGCAAAACCCAGCCGCTTAAGCAGACCATCCACGAGGAAGGCTGCAACAGTCGCACCATCATCAACCGCTTCTGTTACGGCCAGTGCAACTCTTTCTACATCCCCAGGCACATCCGGAAGGAGGAAGGTTCCTTTCAGTCCTGCTCCTTCTGCAAGCCCAAGAAATTCACTACCATGATGGTCACACTCAACTGCCCTGAACTACAGCCACCTACCAAGAAGAAGAGAGTCACACGTGTGAAGCAGTGTCGTTGCATATCCATCGATTTGGATTAAGCCAAATCCAGGTGCACCCAGCATGTCCTAGGAATGCAGCCCCAGGAAGTCCCAGACCTAAAACAACCAGATTCTTACTTGGCTTAAACCTAGAGGCCAGAAGAACCCCCAGCTGCCTCCTGGCAGGAGCCTGCTTGTGCGTAGTTCGTGTGCATGAG

Ensembl | nº de acceso humano

ENSG00000166923

Nº de acceso NCBI

NM_013372

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... GREM1(26585) , GREM1(26585)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Duo Li et al.
Molecular vision, 25, 625-635 (2019-11-09)
To investigate the role of Gremlin-1, which is an endogenous antagonist of the bone morphogenetic protein (BMP) signaling pathway, in inducing epithelium-mesenchymal transition (EMT) in fetal RPE cells after repeated wounds. Subconfluent repetitive passages in fetal RPE cells were regarded
Na Hui Kim et al.
Biochemical and biophysical research communications, 533(4), 1378-1384 (2020-10-25)
Gremlin-1 (GREM1), one of the antagonists of bone morphogenetic proteins (BMPs), has recently been reported to be overexpressed in a variety of cancers including breast cancer. GREM1 is involved in tumor promotion, but little is known about its role in
Kongzu Hu et al.
Molecular medicine reports, 15(4), 2186-2194 (2017-03-06)
Previous research focusing on rodent cells and animal models has demonstrated that gremlin-1 antagonizes bone morphogenetic proteins (BMPs) in order to suppress osteogenesis. However, the impact of gremlin‑1 on osteogenesis in human bone marrow-derived mesenchymal stem cells (MSCs) remains unknown.
Nam Ji Sung et al.
International journal of molecular sciences, 21(23) (2020-12-09)
Gremlin-1 (GREM1), one of the bone morphogenetic protein (BMP) antagonists, can directly bind to BMPs. GREM1 is involved in organogenesis, tissue differentiation, and organ fibrosis. Recently, numerous studies have reported the oncogenic role of GREM1 in cancer. However, the role
Julie R Graham et al.
Journal of cellular biochemistry, 115(9), 1539-1548 (2014-03-19)
Fibrosis is a chronic disease characterized by an excessive deposition of scar tissue in the affected organs. A central mediator of this process is transforming growth factor-β (TGF-β), which stimulates the production of extracellular matrix proteins such as collagens. MicroRNAs

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico