Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU074291

Sigma-Aldrich

MISSION® esiRNA

targeting human LAMA5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCTACACTGCCCTCAAGTTCTACCTGCAGGGCCCAGAGCCTGAGCCTGGGCAGGGTACCGAGGATCGCTTTGTGATGTACATGGGCAGCCGCCAGGCCACTGGGGACTACATGGGTGTGTCTCTGCGTGACAAGAAGGTGCACTGGGTGTATCAGCTGGGTGAGGCGGGCCCTGCAGTCCTAAGCATCGATGAGGACATTGGGGAGCAGTTCGCAGCTGTCAGCCTGGACAGGACTCTCCAGTTTGGCCACATGTCCGTCACAGTGGAGAGACAGATGATCCAGGAAACCAAGGGTGACACGGTGGCCCCTGGGGCAGAGGGGCTGCTCAACCTGCGGCCAGACGACTTCGTCTTCTACGTCGGGGGGTACCCCAGTACCTTCACGCCCCCTCCCCTGCTTCGCTTCCCCGGCTACCGGGGCTGCATCGAGATGGACACGCTGAATGA

Ensembl | nº de acceso humano

ENSG00000130702

Nº de acceso NCBI

NM_005560

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... LAMA5(3911) , LAMA5(3911)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Alex Gordon-Weeks et al.
Cancers, 11(5) (2019-05-09)
Hepatic metastatic growth is dependent upon stromal factors including the matrisomal proteins that make up the extracellular matrix (ECM). Laminins are ECM glycoproteins with several functions relevant to tumour progression including angiogenesis. We investigated whether metastatic colon cancer cells produce
Xuemei Zhang et al.
The journal of maternal-fetal & neonatal medicine : the official journal of the European Association of Perinatal Medicine, the Federation of Asia and Oceania Perinatal Societies, the International Society of Perinatal Obstetricians, 33(7), 1114-1124 (2018-09-12)
Objective: Preeclampsia (PE) is currently thought to associated with oxidative stress and vascular endothelial dysfunction. LAMA5 is associated with the cell migration, proliferation, and vascular endothelial function. The aims of this study are to investigate the expression patterns of LAMA5
Diana Maltseva et al.
Biochimie, 174, 107-116 (2020-04-26)
The interaction of tumor cells with the extracellular matrix (ECM) may affect the rate of cancer progression and metastasis. One of the major components of ECM are laminins, the heterotrimeric glycoproteins consisting of α-, β-, and γ-chains (αβγ). Laminins interact

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico