Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU074231

Sigma-Aldrich

MISSION® esiRNA

targeting human NFASC

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AATGCATTTCCAAAGGATGCCTTTCTCGCCATATGCCTCCCCTGGCCCCCAGCCCCTCTGCCTCGGCCTTGTCAGTTGCTGAGCTGGGCTTGGCTCCTTTCTGGAAAATGACAGTATTTTTGGCAGGGAGAAGGTGCGCAGGCCTCCTTGCTGCTCTCTGGTTTGGTTGGGAGGTGTGTTTACCTCTTGCTCCTCATTCCTCCCCTGCCCTTTTCTCTGGAATATCTAAGATGTGAGCTGCATTGACTCTGAAGACGTTTGAGGAACAGGAGTGGGCACTGATAGAAAGGACTTCAACGCCAGTGACTGTGTACCTCCAGCAGAAGAAAATCAGGTGTCTGGTCTTGGGGGCACTGTGCTCACTTCTAGAGAGAAGAAAAAGGCTGGGTTTGGACTTCATGCCTCCTC

Ensembl | nº de acceso humano

ENSG00000163531

Nº de acceso NCBI

NM_015090

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NFASC(23114) , NFASC(23114)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chang Hoon Bae et al.
Clinical and experimental otorhinolaryngology, 11(2), 124-132 (2018-01-11)
Clusterin (CLU) is known as apolipoprotein J, and has three isoforms with different biological functions. CLU is associated with various diseases such as Alzheimer disease, atherosclerosis, and some malignancies. Recent studies report an association of CLU with inflammation and immune
T-Y Lin et al.
Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology, 44(11), 1347-1360 (2014-09-27)
Infiltration of fibrocytes (FC) in the airway smooth muscle is a feature of asthma, but the pathological significance is unknown. We sought to explore whether FC modulate the phenotype of airway smooth muscle cells (ASMC) in asthmatic vs. control subjects.
Andrea Martello et al.
EMBO reports, 21(7), e48192-e48192 (2020-04-28)
Autophagy is an essential cellular quality control process that has emerged as a critical one for vascular homeostasis. Here, we show that trichoplein (TCHP) links autophagy with endothelial cell (EC) function. TCHP localizes to centriolar satellites, where it binds and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico