Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU073901

Sigma-Aldrich

MISSION® esiRNA

targeting human AXIN1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACTTCTGGTTTGCCTGCACTGGCTTCAGGAAGCTGGAGCCCTGTGACTCGAACGAGGAGAAGAGGCTGAAGCTGGCGAGAGCCATCTACCGAAAGTACATTCTTGATAACAATGGCATCGTGTCCCGGCAGACCAAGCCAGCCACCAAGAGCTTCATAAAGGGCTGCATCATGAAGCAGCTGATCGATCCTGCCATGTTTGACCAGGCCCAGACCGAAATCCAGGCCACTATGGAGGAAAACACCTATCCCTCCTTCCTTAAGTCTGATATTTATTTGGAATATACGAGGACAGGCTCGGAGAGCCCCAAAGTCTGTAGTGACCAGAGCTCTGGGTCAGGGACAGGGAAGGGCATATCTGGATACCTGCCGACCTTAAATGAAGATGAGGAATGGAAGTGTGACCAGG

Ensembl | nº de acceso humano

ENSG00000103126

Nº de acceso NCBI

NM_181050

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... AXIN1(8312) , AXIN1(8312)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
NZU
QPU
FNU
TJU
EEU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yu Chen et al.
PloS one, 10(7), e0133115-e0133115 (2015-07-24)
During development, scaffold proteins serve as important platforms for orchestrating signaling complexes to transduce extracellular stimuli into intracellular responses that regulate dendritic spine morphology and function. Axin ("axis inhibitor") is a key scaffold protein in canonical Wnt signaling that interacts
Shiwei Zhou et al.
Pharmaceutics, 13(3) (2021-04-04)
Genetic evidence has indicated that β-catenin plays a vital role in glucose and lipid metabolism. Here, we investigated whether pyrvinium, an anthelmintic agent previously reported as a down-regulator of cellular β-catenin levels, conferred any metabolic advantages in treatment of metabolic
Yongjuan Zhang et al.
Biochemical and biophysical research communications, 513(1), 261-268 (2019-04-08)
Caveolin-1 has been reported to play an important role in the pathogenesis of acute respiratory distress syndrome (ARDS). This study was designed to identify Caveolin-1-interacting proteins to reveal the molecular mechanisms of ARDS. Yeast two-hybrid screening was performed using Caveolin-1
Dongshao Chen et al.
Cancer management and research, 11, 1349-1362 (2019-02-28)
Characterized by elevated AFP levels in serum, AFP-producing gastric cancer (APGC) is a very special type of gastric cancer (GC) that is difficult to treat and has poor prognosis. However, little is known about the role of AFP in GC
Xiumei Zhang et al.
OncoTargets and therapy, 13, 5819-5830 (2020-07-02)
Evidence describing TMED3 in the context of breast cancer is scarce, and the effect of TMED3 on Wnt/β-catenin signaling in breast cancer has not been reported. The objective of this study was to determine the potential physiological functions and molecular
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico