Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU073721

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPV1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCAGGACAAGTGGGACAGATTCGTCAAGCGCATCTTCTACTTCAACTTCCTGGTCTACTGCCTGTACATGATCATCTTCACCATGGCTGCCTACTACAGGCCCGTGGATGGCTTGCCTCCCTTTAAGATGGAAAAAACTGGAGACTATTTCCGAGTTACTGGAGAGATCCTGTCTGTGTTAGGAGGAGTCTACTTCTTTTTCCGAGGGATTCAGTATTTCCTGCAGAGGCGGCCGTCGATGAAGACCCTGTTTGTGGACAGCTACAGTGAGATGCTTTTCTTTCTGCAGTCACTGTTCATGCTGGCCACCGTGGTGCTGTACTTCAGCCACCTCAAGGAGTATGTGGCTTCCATGGTATTCTCCCTGGCCTTGGGCTGGACCAACATGCTCTACTACACCCGCGGTTTC

Ensembl | nº de acceso humano

ENSG00000196689

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TRPV1(7442) , TRPV1(7442)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
HQS
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Gwan Hee Han et al.
Cancer genomics & proteomics, 17(3), 309-319 (2020-04-30)
Transient receptor potential vanilloid type 1 (TRPV1) has been studied in human malignancies, but has not been studied in epithelial ovarian cancer (EOC). We, therefore, investigated the significance of TRPV1 and correlation with phosphatase and tension homolog (PTEN) in EOC.
Ayumi Maeda et al.
Molecular nutrition & food research, 62(11), e1800086-e1800086 (2018-04-24)
The prevalence of type 2 diabetes mellitus (T2DM) is increasing yearly worldwide. Glycemic control is the basis for the treatment of T2DM, as it can prevent the progress of associated complications. Spices possess various health beneficial effects on humans. The
Mingming Ren et al.
Cardiovascular therapeutics, 34(6), 482-488 (2016-09-24)
Accumulating evidence showed that transient receptor potential channels play an important role in the regulation of cardiomyocyte differentiation. The vanilloid receptor 1 (VR1) is a member of the transient receptor channel super family and is expressed in cardiomyocytes. However, its
Masayoshi Kawase et al.
Scientific reports, 10(1), 9687-9687 (2020-06-18)
Despite successful clinical application of non-equilibrium atmospheric pressure plasma (APP), the details of the molecular mechanisms underlying APP-inducible biological responses remain ill-defined. We previously reported that exposure of 3T3L1 cells to APP-irradiated buffer raised the cytoplasmic free Ca2+ ([Ca2+]i) concentration
Shuo Wang et al.
Channels (Austin, Tex.), 14(1), 59-68 (2020-02-23)
The natural outcome of abdominal aortic aneurysm (AAA) is that of slow progression and ultimate rupture, then a life-threatening hemorrhage consequently. Ruptured AAA is a dramatic catastrophe and constitutes one of the leading causes of acute death in elderly men.
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico