Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU072971

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGCTAAGCCGACCATTTCAGAATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAGCTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTTCATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGATTGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATGACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTACAAGGAAAAC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hirofumi Noguchi et al.
Scientific reports, 8(1), 11082-11082 (2018-07-25)
We previously reported that treatment with a JNK inhibitory peptide (11R-JNKI) prevents islet apoptosis and enhances the islet function in vivo. In the present study, we explored more efficient JNK inhibitors. The inhibition of the JNK activity by five types
Wen-Pin Cheng et al.
Journal of the Formosan Medical Association = Taiwan yi zhi, 116(5), 388-397 (2016-09-21)
TRB3 (tribbles 3), an apoptosis-regulated gene, increases during endoplasmic reticulum stress. Hypoxia can induce inflammatory mediators and apoptosis in cardiomyocytes. However, the expression of TRB3 in cardiomyocyte apoptosis under hypoxia is not thoroughly known. We investigated the regulation mechanism of
Lan Xu et al.
Journal of molecular endocrinology (2019-03-27)
Obesity is a worldwide health problem with rising incidence and results in reproductive difficulties. Elevated saturated free fatty acids (FFAs) in obesity can cause insulin resistance (IR) in peripheral tissues. The high intra-follicular saturated FFAs may also account for IR
Lei Zhou et al.
Oncotarget, 8(55), 94009-94019 (2017-12-08)
Isoflurane can provide both neuroprotection and neurotoxicity in various culture models and in rodent developing brains. Emulsified Isoflurane (EI) is an emulsion formulation of isoflurane, while its underlying molecular mechanism of developemental nerve toxicity largely remains unclear. We hypothesized that
Xu Qin et al.
Molecular carcinogenesis, 53(7), 526-536 (2013-01-30)
The c-Jun NH2 -terminal kinase (JNK) signal pathway has been implicated in the growth, cellular proliferation, and apoptosis in many kinds of carcinomas. However, the role of JNK in the development of esophageal squamous cell carcinomas (ESCCs) is unknown. To

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico