Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU072291

Sigma-Aldrich

MISSION® esiRNA

targeting human BCAT1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CATATGCTGACGGTGGAGTGGTCCTCAGAGTTTGGATGGGAGAAACCTCATATCAAGCCTCTTCAGAACCTGTCATTGCACCCTGGCTCATCAGCTTTGCACTATGCAGTGGAATTATTTGAAGGATTGAAGGCATTTCGAGGAGTAGATAATAAAATTCGACTGTTTCAGCCAAACCTCAACATGGATAGAATGTATCGCTCTGCTGTGAGGGCAACTCTGCCGGTATTTGACAAAGAAGAGCTCTTAGAGTGTATTCAACAGCTTGTGAAATTGGATCAAGAATGGGTCCCATATTCAACATCTGCTAGTCTGTATATTCGTCCTACATTCATTGGAACTGAGCCTTCTCTTGGAGTCAAGAAGCCTACCAAAGCCCTGCTCTTTGTACTCTTGAGCCCAGTGGGACCTTATTTTTCAAGTGGAACCTTTAATCCAGTGTCCCTGTGGG

Ensembl | nº de acceso humano

ENSG00000060982

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BCAT1(586) , BCAT1(586)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

M Harris et al.
Free radical biology & medicine, 152, 755-766 (2020-01-27)
Leucine, nutrient signal and substrate for the branched chain aminotransferase (BCAT) activates the mechanistic target of rapamycin (mTORC1) and regulates autophagic flux, mechanisms implicated in the pathogenesis of neurodegenerative conditions such as Alzheimer's disease (AD). BCAT is upregulated in AD
Xiumin Lin et al.
OncoTargets and therapy, 13, 3583-3594 (2020-05-20)
Dysregulation of BCAT1 has been implicated in carcinogenesis. However, its clinical significance and biological roles in human non-small cell lung cancer (NSCLC) are not clear. Immunohistochemistry was used to examine the protein expression of BCAT1 in 107 cases of lung

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico