Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU071901

Sigma-Aldrich

MISSION® esiRNA

targeting human WSB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTATTGAGGGGGCATCAGAATTGGGTGTACAGCTGTGCATTCTCTCCTGACTCTTCTATGCTGTGTTCAGTCGGAGCCAGTAAAGCAGTTTTCCTTTGGAATATGGATAAATACACCATGATACGGAAACTAGAAGGACATCACCATGATGTGGTAGCTTGTGACTTTTCTCCTGATGGAGCATTACTGGCTACTGCATCTTATGATACTCGAGTATATATCTGGGATCCACATAATGGAGACATTCTGATGGAATTTGGGCACCTGTTTCCCCCACCTACTCCAATATTTGCTGGAGGAGCAAATGACCGGTGGGTACGATCTGTATCTTTTAGCCATGATGGACTGCATGTTGCAAGCCTTGCTGATGATAAAATGGTGAGGTTCTGGAGAATTGATGAGGATTATCCAGTGCAAGTTGCACCTTTGAGCAATGGTCTTTGCTGTGCCTT

Ensembl | nº de acceso humano

ENSG00000109046

Nº de acceso NCBI

NM_134265

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... WSB1(26118) , WSB1(26118)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Flore-Anne Poujade et al.
British journal of cancer, 118(9), 1229-1237 (2018-03-16)
Metastatic spread is responsible for the majority of cancer-associated deaths. The tumour microenvironment, including hypoxia, is a major driver of metastasis. The aim of this study was to investigate the role of the E3 ligase WSB-1 in breast cancer biology
Jung Jin Kim et al.
Cell research, 27(2), 274-293 (2016-12-14)
Oncogene-induced senescence (OIS) or apoptosis through the DNA-damage response is an important barrier of tumorigenesis. Overcoming this barrier leads to abnormal cell proliferation, genomic instability, and cellular transformation, and finally allows cancers to develop. However, it remains unclear how the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico