Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU071361

Sigma-Aldrich

MISSION® esiRNA

targeting human SFPQ

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGGTTGTTTGTTGGGAATCTACCTGCTGATATCACGGAGGATGAATTCAAAAGACTATTTGCTAAATATGGAGAACCAGGAGAAGTTTTTATCAACAAAGGCAAAGGATTCGGATTTATTAAGCTTGAATCTAGAGCTTTGGCTGAAATTGCCAAAGCCGAACTGGATGATACACCCATGAGAGGTAGACAGCTTCGAGTTCGCTTTGCCACACATGCTGCTGCCCTTTCTGTTCGTAATCTTTCACCTTATGTTTCCAATGAACTGTTGGAAGAAGCCTTTAGCCAATTTGGTCCTATTGAAAGGGCTGTTGTAATAGTGGATGATCGTGGAAGATCTACAGGGAAAGGCATTGTTGAATTTGCTTCTAAGCCAGCAGCAAGAAAGGCATTTGAACGATGCAGTGAAGG

Ensembl | nº de acceso humano

ENSG00000116560

Nº de acceso NCBI

NM_005066

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SFPQ(6421) , SFPQ(6421)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mirjana Malnar et al.
Journal of cell science, 134(4) (2021-01-27)
The expanded GGGGCC repeat mutation in the C9orf72 gene is the most common genetic cause of the neurodegenerative diseases amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). The expansion is transcribed to sense and antisense RNA, which form RNA foci
Lotte Victoria Winther Stagsted et al.
eLife, 10 (2021-01-22)
Circular RNAs (circRNAs) represent an abundant and conserved entity of non-coding RNAs; however, the principles of biogenesis are currently not fully understood. Here, we identify two factors, splicing factor proline/glutamine rich (SFPQ) and non-POU domain-containing octamer-binding protein (NONO), to be

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico