Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU071121

Sigma-Aldrich

MISSION® esiRNA

targeting human NLRP3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACCTGGAGGATGTGGACTTGAAGAAATTTAAGATGCACTTAGAGGACTATCCTCCCCAGAAGGGCTGCATCCCCCTCCCGAGGGGTCAGACAGAGAAGGCAGACCATGTGGATCTAGCCACGCTAATGATCGACTTCAATGGGGAGGAGAAGGCGTGGGCCATGGCCGTGTGGATCTTCGCTGCGATCAACAGGAGAGACCTTTATGAGAAAGCAAAAAGAGATGAGCCGAAGTGGGGTTCAGATAATGCACGTGTTTCGAATCCCACTGTGATATGCCAGGAAGACAGCATTGAAGAGGAGTGGATGGGTTTACTGGAGTACCTTTCGAGAATCTCTATTTGTAAAATGAAGAAAGATTACCGTAAGAAGTACAGAAAGTACGTGAGAAGCAGATTCCAGTGCATTGAA

Ensembl | nº de acceso humano

ENSG00000162711

Nº de acceso NCBI

NM_183395

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NLRP3(114548) , NLRP3(114548)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qin Hu et al.
BioFactors (Oxford, England), 44(2), 123-136 (2017-12-02)
Increasing evidence demonstrates that pyroptosis, pro-inflammatory programmed cell death, is linked to atherosclerosis; however, the underlying mechanisms remain to be elucidated. Dihydromyricetin (DHM), a natural flavonoid, was reported to exert anti-oxidative and anti-inflammatory bioactivities. However, the effect of DHM on
Maureen C Ty et al.
EMBO molecular medicine, 11(8), e9903-e9903 (2019-07-03)
Malaria is a highly inflammatory disease caused by Plasmodium infection of host erythrocytes. However, the parasite does not induce inflammatory cytokine responses in macrophages in vitro and the source of inflammation in patients remains unclear. Here, we identify oxidative stress, which
S F Khaiboullina et al.
Scientific reports, 7(1), 16050-16050 (2017-11-24)
ZIKV causes microcephaly by crossing the placental barrier, however, the mechanism of trans-placental dissemination of ZIKV remains unknown. Here, we sought to determine whether monocytes, which can cross tissue barriers, assist ZIKV dissemination to the fetus. We determined this by infecting monocytes
Zhe Lin et al.
Biochimica et biophysica acta. Molecular basis of disease, 1864(9 Pt B), 2890-2900 (2018-06-03)
Oxidative stress and inflammation are closely related to cardiovascular diseases. Although hydrogen sulfide (H2S) has been shown to have powerful anti-oxidative and anti-inflammatory properties, its role in macrophage inflammation was poorly understood. The aim of this study was to investigate
Qianjin Liu et al.
Redox biology, 34, 101560-101560 (2020-05-16)
Morphine is frequently used for pain relief, but long-term morphine therapy in patients with chronic pain results in analgesic tolerance and hyperalgesia. There are no effective therapeutic treatments that limit these detrimental side effects. We found pretreatment with melatonin could
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico