Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU070341

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP16

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGGTGTACCTGACCAGACAAGAGGTAGCTCCAAATTTCATATTCGTCGAAAGCGATATGCATTGACAGGACAGAAATGGCAGCACAAGCACATCACTTACAGTATAAAGAACGTAACTCCAAAAGTAGGAGACCCTGAGACTCGTAAAGCTATTCGCCGTGCCTTTGATGTGTGGCAGAATGTAACTCCTCTGACATTTGAAGAAGTTCCCTACAGTGAATTAGAAAATGGCAAACGTGATGTGGATATAACCATTATTTTTGCATCTGGTTTCCATGGGGACAGCTCTCCCTTTGATGGAGAGGGAGGATTTTTGGCACATGCCTACTTCCCTGGACCAGGAATTGGAGGAGATACCCATTTTGACTCAGATGAGCCATGGACACTAGGAAATCCTAATCATGATGGAAATGACTTATTTCTTGTAGCAGTCCATGAACTGGGACATGCTCTG

Ensembl | nº de acceso humano

ENSG00000156103

Nº de acceso NCBI

NM_005941

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MMP16(4325) , MMP16(4325)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hanan S Elsarraj et al.
NPJ breast cancer, 6, 12-12 (2020-05-01)
The molecular processes by which some human ductal carcinoma in situ (DCIS) lesions advance to the more aggressive form, while others remain indolent, are largely unknown. Experiments utilizing a patient-derived (PDX) DCIS Mouse INtraDuctal (MIND) animal model combined with ChIP-exo
Ji Wook Moon et al.
Cancer genetics, 208(5), 261-270 (2015-05-24)
The gene MT3-MMP (also known as MMP16) encodes the membrane type 3 matrix metalloproteinase, which is a member of the matrix metalloproteinase (MMP) gene family. Several MMPs are associated with migration in colorectal cancer (CRC). However, the methylation status of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico