Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU067851

Sigma-Aldrich

MISSION® esiRNA

targeting human BIRC3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGACTTGTGTAATTCCAATCCTGGATAGTCTACTAACTGCCGGAATTATTAATGAACAAGAACATGATGTTATTAAACAGAAGACACAGACGTCTTTACAAGCAAGAGAACTGATTGATACGATTTTAGTAAAAGGAAATATTGCAGCCACTGTATTCAGAAACTCTCTGCAAGAAGCTGAAGCTGTGTTATATGAGCATTTATTTGTGCAACAGGACATAAAATATATTCCCACAGAAGATGTTTCAGATCTACCAGTGGAAGAACAATTGCGGAGACTACAAGAAGAAAGAACATGTAAAGTGTGTATGGACAAAGAAGTGTCCATAGTGTTTATTCCTTGTGGTCATCTAGTAGTATGCAAAGATTGTGCTCCTTCTTTAAGAAAGTGTCCTATTTGTAGGAGTACAATCAAGGGTACAGTTCGTACATTTCTTTCATGAAGAAGAACCAAAACATCG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

M Lappas
Placenta, 35(10), 831-838 (2014-08-13)
Independent of their role in apoptosis, cellular inhibitors of apoptosis (cIAP) 1 and 2, have emerged as regulators of inflammation. Obesity in pregnancy is characterised by maternal and placental inflammation. Thus, the aim of this study was to determine the
Hong Jin et al.
Oncology research, 22(3), 167-176 (2015-07-15)
Emerging evidence suggests a potential role of cellular inhibitor of apoptosis protein 1 (cIAP1) in the development of human ovarian cancer. However, its function in the progression of ovarian cancer has not been clearly determined. Our study aimed to investigate
E-W Lee et al.
Cell death and differentiation, 22(9), 1463-1476 (2015-01-24)
Given their crucial role in apoptosis suppression, inhibitor of apoptosis proteins (IAPs) have recently become attractive targets for cancer therapy. Here, we report that cellular IAP2 (cIAP2) is specifically stabilized in several cancer cell lines, leading to resistance to Smac

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico