Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU067151

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP13

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGTCCAGGAGATGAAGACCCCAACCCTAAACATCCAAAAACGCCAGACAAATGTGACCCTTCCTTATCCCTTGATGCCATTACCAGTCTCCGAGGAGAAACAATGATCTTTAAAGACAGATTCTTCTGGCGCCTGCATCCTCAGCAGGTTGATGCGGAGCTGTTTTTAACGAAATCATTTTGGCCAGAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTTCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAAAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nobuaki Ozeki et al.
International journal of molecular sciences, 17(2), 221-221 (2016-02-11)
We established a differentiation method for homogeneous α7 integrin-positive human skeletal muscle stem cell (α7⁺hSMSC)-derived osteoblast-like (α7⁺hSMSC-OB) cells, and found that interleukin (IL)-1β induces matrix metalloproteinase (MMP)-13-regulated proliferation of these cells. These data suggest that MMP-13 plays a potentially unique
Xiao-Dong Li et al.
Chinese medical journal, 130(6), 717-721 (2017-03-18)
Dendritic cells are professional antigen-presenting cells found in an immature state in epithelia and interstitial space, where they capture antigens such as pathogens or damaged tissue. Matrix metallopeptidase 13 (MMP-13), a member of the collagenase subfamily, is involved in many
Rui Min Li et al.
American journal of cancer research, 8(6), 964-980 (2018-07-24)
The highly refractory nature of cervical cancer to chemotherapeutic drugs and its epithelial-to-mesenchymal transition (EMT) are the key reasons contributing to the poor prognosis of this disease. Golgi Membrane Protein 1 (GOLM1), a protein involved in the trafficking of proteins
Chia-Li M Shih et al.
Molecular biology reports, 42(7), 1225-1232 (2015-02-16)
Adipose tissue remodeling by the matrix metalloproteases (MMPs) is critical for tissue hypertrophy and obesity. MMP-13 is an important protein that is highly expressed in adipose tissue but whose potential role in adipose tissue expansion is poorly characterized. We investigated

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico