Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU065551

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP11C

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAGAAAGAGCGAGAGACCTTGAAGGTTTTAAAAATGTTCACCGACTTCCTATCATTTATGGTTCTATTCAACTTTATCATTCCTGTCTCCATGTACGTCACAGTAGAAATGCAGAAATTCTTGGGCTCCTTCTTCATCTCATGGGATAAGGACTTTTATGATGAAGAAATTAATGAAGGAGCCCTGGTTAACACATCAGACCTTAATGAAGAACTTGGTCAGGTGGATTATGTATTTACAGATAAGACTGGAACACTCACTGAAAACAGCATGGAATTCATTGAATGCTGCATAGATGGCCACAAATATAAAGGTGTAACTCAAGAGGTTGATGGATTATCTCAAACTGATGGAACTTTAACATATTTTGACAAAGTAGATAAGAATCGAGAAGAGCTGTTTCTACGTGCCTTGTGTTTATGTCATACTGTAGAAATCAAAACAAACGATGCTGTTGATGGAGCTA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Donatien Kamdem Toukam et al.
PloS one, 7(5), e38068-e38068 (2012-06-06)
Although human immunodeficiency type 1 (HIV-1) infection induces strong antibody responses to the viral envelope glycoprotein (Env) only a few of these antibodies possess the capacity to neutralize a broad range of strains. The induction of such antibodies represents an
Theo Rispens et al.
PloS one, 8(2), e55566-e55566 (2013-02-08)
IgE antibodies to gal-α-1,3-gal-β-1,4-GlcNAc (α-gal) can mediate a novel form of delayed anaphylaxis to red meat. Although IgG antibodies to α-gal (anti-α-gal or anti-Gal) are widely expressed in humans, IgE anti-α-gal is not. We explored the relationship between the IgG
Pallara Janardhanan Wills et al.
PloS one, 11(4), e0152787-e0152787 (2016-04-14)
Lepidopterism is a disease caused by the urticating scales and toxic fluids of adult moths, butterflies or its caterpillars. The resulting cutaneous eruptions and systemic problems progress to clinical complications sometimes leading to death. High incidence of fever epidemics were
Alessandra Ghiani et al.
PloS one, 11(5), e0155803-e0155803 (2016-05-18)
Tomato (Solanum lycopersicum) is one of the most extensively consumed vegetables but, unfortunately, it is also able to induce allergic reactions. In the past, it has been shown that the choice of tomato cultivar significantly influenced the allergic reaction of
Yan-Da Lai et al.
International journal of molecular sciences, 17(2), 214-214 (2016-02-11)
Vascular endothelial growth factor (VEGF) is an important stimulator for angiogenesis in solid tumors. Blocking VEGF activity is an effective therapeutic strategy to inhibit tumor growth and metastasis. Avastin, a humanized monoclonal antibody recognizes VEGF, has been approved by the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico