Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU065291

Sigma-Aldrich

MISSION® esiRNA

targeting human NFAT5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATCCTATTGCCGATGCTCAGAACCTTTCCCAGGAAACTCAAGGTTCTCTCTTTCATAGTCCAAATCCTATTGTCCACAGTCAGACTTCTACAACCTCCTCTGAACAAATGCAGCCTCCAATGTTTCACTCTCAAAGTACCATTGCTGTGTTACAGGGCTCTTCAGTTCCTCAAGACCAGCAGTCAACCAACATATTTCTTTCCCAGAGTCCCATGAATAATCTTCAGACTAACACAGTAGCCCAAGAAGCATTTTTTGCAGCACCGAACTCAATTTCTCCACTTCAGTCAACATCAAACAGTGAACAACAAGCTGCTTTCCAACAGCAAGCTCCAATATCACACATCCAGACTCCTATGCTTTCCCAAGAACAGGCACAACCCCCGCAGCAGGGTTTATTTCAGCCTCAGGTGGCCCTGGGCTCCCTTCCACCTAATCCAATGCCTCAAAGCCAACAAGGAACCAT

Ensembl | nº de acceso humano

ENSG00000102908

Nº de acceso NCBI

NM_006599

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NFAT5(10725) , NFAT5(10725)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sandrine Herbelet et al.
International journal of molecular sciences, 21(21) (2020-10-30)
Duchenne muscular dystrophy (DMD) is characterized by chronic inflammation and fibrotic tissue production by fibroblasts. The promyogenic factor nuclear factor of activated T-cells 5 (NFAT5) is virtually present in all cells, responding to hyperosmolar or pro-inflammatory stress. In embryogenic fibroblasts
Saseong Lee et al.
Journal of immunology (Baltimore, Md. : 1950), 201(2), 359-370 (2018-05-26)
Fibroblast-like synoviocytes (FLSs) play a key role in the progression of rheumatoid arthritis (RA) as a primary component of invasive hypertrophied pannus. FLSs of RA patients (RA-FLSs) exhibit cancer-like features, including promigratory and proinvasive activities that largely contribute to joint
Sandrine Herbelet et al.
International journal of molecular sciences, 21(23) (2020-12-09)
Glucocorticoids are drugs of choice in Duchenne muscular dystrophy (DMD), prolonging patients' ambulation. Their mode of action at the protein level is not completely understood. In DMD, muscle tissue is replaced by fibrotic tissue produced by fibroblasts, reducing mobility. Nuclear
Moritz Veltmann et al.
PloS one, 11(1), e0147312-e0147312 (2016-01-23)
Although systemic hypertension is a risk factor of age-related macular degeneration, antihypertensive medications do not affect the risk of the disease. One condition that induces hypertension is high intake of dietary salt resulting in increased blood osmolarity. In order to
Wei He et al.
Nature communications, 11(1), 1732-1732 (2020-04-09)
High-salt diets are associated with an elevated risk of autoimmune diseases, and immune dysregulation plays a key role in cancer development. However, the correlation between high-salt diets (HSD) and cancer development remains unclear. Here, we report that HSD increases the
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico