Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU065101

Sigma-Aldrich

MISSION® esiRNA

targeting human TRO

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACAAAGATCCCCATCAAACGCTCAGACATGCTGAGGGATGTCATCCAAGAATATGATGAATATTTCCCAGAAATCATTGAACGAGCAAGCTACACTCTGGAGAAGATGTTTCGAGTCAATCTGAAAGAAATTGATAAGCAAAGTAGCTTGTATATTCTCATCAGCACTCAGGAATCCTCTGCAGGCATACTGGGAACGACCAAGGACACACCCAAGCTGGGTCTCCTCATGGTGATTCTGAGTGTCATTTTTATGAATGGCAACAAGGCCAGTGAGGCTGTCATCTGGGAGGTGCTGCGCAAGTTGGGGCTGCGCCCTGGGGTGAGGCATTCACTCTTTGGGGAAGTGAGGAAGCTCATCACAGACGAGTTTGTGAAGCAGAAGTACCTGGAGTACAAGAGGGTCCCTAACAGCA

Ensembl | nº de acceso humano

ENSG00000067445

Nº de acceso NCBI

NM_016157

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TRO(7216) , TRO(7216)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Guoshuai Cao et al.
Cancer communications (London, England), 41(1), 51-61 (2021-07-09)
The interaction between activating receptor NKp30 and its major tumor ligand B7-H6 is important for NK cell-mediated tumor rejection. However, the regulation of B7-H6 by tumor therapeutics remains largely unknown. In this study, we investigated the regulation of B7-H6 by
Min Young Ahn et al.
Journal of vascular research, 55(2), 75-86 (2018-02-07)
Thrombospondin-1 (TSP-1) is implicated in vascular diseases associated with oxidative stress, such as abdominal aortic aneurysms, ischemia-reperfusion injury, and atherosclerosis. However, the regulatory mechanisms underlying TSP-1 expression are not fully elucidated. In this study, we found that peroxisome proliferator-activated receptor
Hongyong Fu et al.
Molecular therapy. Nucleic acids, 12, 769-786 (2018-08-25)
Spermatogonial stem cells (SSCs) have significant applications in reproductive and regenerative medicine. However, nothing is known about genes in mediating human SSCs. Here we have explored for the first time the function and mechanism of P21-activated kinase 1 (PAK1) in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico