Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU064531

Sigma-Aldrich

MISSION® esiRNA

targeting human TANK

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACGTGAACAACAGGAACAGCTGTCACTTCAACAGACTATTATTGACAAGCTAAAATCTCAGTTACTTCTTGTGAATTCCACTCAAGATAACAATTATGGCTGTGTTCCTCTGCTTGAAGACAGTGAAACAAGAAAGAATAATTTGACTCTTGATCAGCCACAAGATAAAGTGATTTCAGGAATAGCAAGAGAAAAACTACCAAAGGTAAGAAGACAAGAGGTTTCTTCTCCTAGAAAAGAAACTTCAGCAAGGAGTCTTGGCAGTCCTTTGCTCCATGAAAGGGGTAATATAGAGAAGACTTTCTGGGATCTGAAAGAAGAATTTCATAAAATATGCATGCTAGCAAAAGCACAGAAAGACCACTTAAGCAAACTTAATATACCAGACACTGCAACTGAAACACAGTGCTCTGTGCCTATACAGTGTACGGATAAAACAGATAAACAAGAAGCGCTGTTTAAGCCTCA

Ensembl | nº de acceso humano

ENSG00000136560

Nº de acceso NCBI

NM_004180

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TANK(10010) , TANK(10010)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hong Cheng et al.
The Journal of investigative dermatology, 135(10), 2427-2436 (2015-05-29)
Previously, tumor necrosis factor (TNF)-like weak inducer of apoptosis (TWEAK) had been known to be an inducer of apoptosis of keratinocytes by engaging the Fn14 receptor. However, the high-risk human papillomavirus (HPV) infection confers a proliferation advantage on keratinocytes that
I Karl et al.
Cell death & disease, 5, e1444-e1444 (2014-10-10)
The relevance of the adaptor protein TNF receptor-associated factor 2 (TRAF2) for signal transduction of the death receptor tumour necrosis factor receptor1 (TNFR1) is well-established. The role of TRAF2 for signalling by CD95 and the TNF-related apoptosis inducing ligand (TRAIL)
Alexey V Sorokin et al.
Cancer research, 75(9), 1846-1858 (2015-04-17)
The protein tyrosine phosphatase receptor PTPRN2 is expressed predominantly in endocrine and neuronal cells, where it functions in exocytosis. We found that its immature isoform proPTPRN2 is overexpressed in various cancers, including breast cancer. High proPTPRN2 expression was associated strongly

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico