Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU064361

Sigma-Aldrich

MISSION® esiRNA

targeting human NOX4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTCCTCATGATCACAGCCTCTACATATGCAATAAGAGTTTCTAACTATGATATCTTCTGGTATACTCATAACCTCTTCTTTGTCTTCTACATGCTGCTGACGTTGCATGTTTCAGGAGGGCTGCTGAAGTATCAAACTAATTTAGATACCCACCCTCCCGGCTGCATCAGTCTTAACCGAACCAGCTCTCAGAATATTTCCTTACCAGAGTATTTCTCAGAACATTTTCATGAACCTTTCCCTGAAGGATTTTCAAAACCGGCAGAGTTTACCCAGCACAAATTTGTGAAGATTTGTATGGAAGAGCCCAGATTCCAAGCTAATTTTCCACAGACTTGGCTTTGGATTTCTGGACCTTTGTGCCTGTACTGTGCCGAAAGACTTTACAGGTATATCCGGAGCAATAAGCCAGTCACCATCATTTCGGTCATGAGTCATCCCTCAGATGTCATGGAAATCCGAATGGTCAA

Ensembl | nº de acceso humano

ENSG00000086991

Nº de acceso NCBI

NM_016931

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NOX4(50507) , NOX4(50507)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wenwen Zhao et al.
Scientific reports, 7(1), 12953-12953 (2017-10-13)
ICAM-1 overexpression and subsequent adhesion of leukocytes to endothelial cells play critical roles in the early stage of atherosclerosis. Danshenol A (DA) is an abietane-type diterpenoid isolated from traditional Chinese herb Salvia miltiorrhiza Bunge. The mechanisms under its regulation of
Weichao Guo et al.
American journal of physiology. Lung cellular and molecular physiology, 312(6), L936-L944 (2017-03-25)
Myofibroblasts are important mediators of fibrogenesis; thus blocking fibroblast-to-myofibroblast differentiation (FMD) may be an effective strategy to treat pulmonary fibrosis (PF). Previously, we reported that histone deacetylase 4 (HDAC4) activity is necessary for transforming growth factor-β
Qian Sun et al.
Biochimica et biophysica acta, 1861(1 Pt A), 2912-2921 (2016-10-23)
Oxidative stress plays a crucial role in the development of alcoholic liver disease (ALD), however effective pharmacological treatment for oxidative injury is still lacking. The objective of this study was to determine whether inhibition of NADPH oxidase activity could reverse
Ha-Reum Lee et al.
Arthritis research & therapy, 22(1), 116-116 (2020-05-18)
Reactive oxygen species (ROS) regulate the migration and invasion of fibroblast-like synoviocytes (FLS), which are key effector cells in rheumatoid arthritis (RA) pathogenesis. Nicotinamide adenine dinucleotide phosphate oxidase 4 (NOX4) induces ROS generation and, consequently, enhances cell migration. Despite the
Yongpan Huang et al.
Oxidative medicine and cellular longevity, 2020, 3912173-3912173 (2020-12-05)
Oxymatrine (OMT) is the major quinolizidine alkaloid extracted from the root of Sophora flavescens Ait and has been shown to exhibit a diverse range of pharmacological properties. The aim of the present study was to investigate the role of OMT
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico