Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU063941

Sigma-Aldrich

MISSION® esiRNA

targeting human FHL2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCCTCACAGAGAGGGACGACATCCTGTGCCCCGACTGTGGGAAAGACATCTGAATTCAACACAGAGAAGTTGCTGCTTGTGATCTCACACACAGATTTTTATGTTTTCTTTCTCACCCAGGCAATCTTGCCTTCTGGTTTCTTCCAGCCACATTGAGACTTTCTTCTAGTGCTTTTCAGTGATACTCACGTTTGCTTAAACCCTTTAGTGCTTTGTGATAGTTCAGTCCCAGGGAAAGAGAAAACTCGCCCTAGGCCCTAGGTGGGAAGATGGTTTGAAATTTTTGTAATCGAGTAAGGCACACCCAAATGTAAAAATCCTTTTGAATGATGCCTTTATAAATCTTTCTCTCACTGTCTATTTAAGTGCAATTAACATATGTCACGAACTTGAAAGTTTTCTAAACTCAATAAGGTAATGACCAGTTGTTATTTACAGCTCTGTAACCTCCCGTTGCGTCAAGTCTAAACC

Ensembl | nº de acceso humano

ENSG00000115641

Nº de acceso NCBI

NM_001450

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FHL2(2274) , FHL2(2274)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Szu-Yuan Li et al.
Scientific reports, 9(1), 6693-6693 (2019-05-02)
RAAS inhibition has been the standard treatment for CKD for years because it can reduce proteinuria and hence retard renal function decline, but the proteinuria reduction effect is still insufficient in many patients. Podocyte foot process and slit diaphragm are
Xuejing Jin et al.
Gene, 669, 99-106 (2018-05-26)
Increasing evidence demonstrates that the four and a half LIM domain (FHL) gene and its protein products have different functions in the progression of various malignancies. However, the role of FHL protein 2 (FHL2) in cervical cancer (CC) has not

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico